Multiple sequence alignment - TraesCS6A01G049700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G049700 chr6A 100.000 3134 0 0 1 3134 25524703 25527836 0.000000e+00 5788.0
1 TraesCS6A01G049700 chr6A 95.642 2478 62 11 1 2476 25106445 25108878 0.000000e+00 3936.0
2 TraesCS6A01G049700 chr6A 96.280 2285 45 6 1 2285 25313175 25315419 0.000000e+00 3712.0
3 TraesCS6A01G049700 chr6A 95.936 2190 59 5 287 2476 25472022 25474181 0.000000e+00 3524.0
4 TraesCS6A01G049700 chr6A 93.841 1916 74 16 276 2181 25069687 25071568 0.000000e+00 2844.0
5 TraesCS6A01G049700 chr6A 97.520 1492 16 4 985 2476 25408352 25409822 0.000000e+00 2531.0
6 TraesCS6A01G049700 chr6A 96.391 1524 47 2 1 1522 25202392 25203909 0.000000e+00 2503.0
7 TraesCS6A01G049700 chr6A 97.494 1197 30 0 287 1483 25580359 25581555 0.000000e+00 2045.0
8 TraesCS6A01G049700 chr6A 92.152 1185 63 9 1298 2476 25581334 25582494 0.000000e+00 1646.0
9 TraesCS6A01G049700 chr6A 89.700 1233 88 18 1262 2476 25203685 25204896 0.000000e+00 1537.0
10 TraesCS6A01G049700 chr6A 98.790 661 4 4 2476 3134 25409851 25410509 0.000000e+00 1173.0
11 TraesCS6A01G049700 chr6A 97.277 661 13 4 2476 3134 25474210 25474867 0.000000e+00 1116.0
12 TraesCS6A01G049700 chr6A 96.833 663 17 4 2476 3134 25582523 25583185 0.000000e+00 1105.0
13 TraesCS6A01G049700 chr6A 96.662 659 20 2 2476 3134 25213423 25214079 0.000000e+00 1094.0
14 TraesCS6A01G049700 chr6A 95.903 659 22 2 2476 3134 25137648 25138301 0.000000e+00 1062.0
15 TraesCS6A01G049700 chr6A 96.667 420 11 2 2717 3134 25316199 25316617 0.000000e+00 695.0
16 TraesCS6A01G049700 chr6A 99.344 305 2 0 1 305 25407483 25407787 1.270000e-153 553.0
17 TraesCS6A01G049700 chr6A 98.837 258 3 0 1 258 25471769 25472026 7.920000e-126 460.0
18 TraesCS6A01G049700 chr6A 98.837 258 3 0 1 258 25580106 25580363 7.920000e-126 460.0
19 TraesCS6A01G049700 chr6A 97.541 244 3 3 2476 2717 25315608 25315850 6.250000e-112 414.0
20 TraesCS6A01G049700 chr6A 98.113 159 3 0 2318 2476 25315421 25315579 8.560000e-71 278.0
21 TraesCS6A01G049700 chr6A 88.462 78 7 1 1 78 565053041 565053116 3.330000e-15 93.5
22 TraesCS6A01G049700 chrUn 92.551 1705 88 9 483 2166 94315886 94317572 0.000000e+00 2409.0
23 TraesCS6A01G049700 chrUn 92.617 1693 88 8 483 2166 94279963 94281627 0.000000e+00 2399.0
24 TraesCS6A01G049700 chrUn 92.062 1688 113 15 483 2166 94399208 94400878 0.000000e+00 2355.0
25 TraesCS6A01G049700 chrUn 92.221 1684 88 8 483 2166 94374281 94375921 0.000000e+00 2344.0
26 TraesCS6A01G049700 chrUn 92.162 1684 86 11 483 2166 94456416 94458053 0.000000e+00 2337.0
27 TraesCS6A01G049700 chrUn 91.525 1711 90 7 483 2166 325491020 325489338 0.000000e+00 2305.0
28 TraesCS6A01G049700 chrUn 89.482 1274 91 12 899 2166 94214509 94215745 0.000000e+00 1570.0
29 TraesCS6A01G049700 chrUn 91.996 912 58 8 1261 2166 355223290 355224192 0.000000e+00 1266.0
30 TraesCS6A01G049700 chrUn 91.776 912 57 7 1261 2166 284307042 284307941 0.000000e+00 1253.0
31 TraesCS6A01G049700 chr6B 89.829 1288 104 14 899 2166 43384163 43385443 0.000000e+00 1628.0
32 TraesCS6A01G049700 chr6B 89.037 1277 108 17 899 2166 43436239 43437492 0.000000e+00 1554.0
33 TraesCS6A01G049700 chr6B 89.370 809 72 10 899 1699 43474871 43475673 0.000000e+00 1005.0
34 TraesCS6A01G049700 chr6B 88.462 78 7 1 1 78 149020819 149020744 3.330000e-15 93.5
35 TraesCS6A01G049700 chr4D 94.824 541 17 6 2476 3006 495450493 495449954 0.000000e+00 833.0
36 TraesCS6A01G049700 chr4D 96.234 239 9 0 2181 2419 495450877 495450639 2.930000e-105 392.0
37 TraesCS6A01G049700 chr4D 96.104 231 9 0 2175 2405 495451414 495451184 8.200000e-101 377.0
38 TraesCS6A01G049700 chr4D 92.268 194 15 0 88 281 105123154 105122961 3.080000e-70 276.0
39 TraesCS6A01G049700 chr5B 85.938 448 52 8 2529 2976 658338330 658338766 4.730000e-128 468.0
40 TraesCS6A01G049700 chr5B 93.122 189 12 1 90 278 659093900 659094087 3.080000e-70 276.0
41 TraesCS6A01G049700 chr7D 85.169 445 55 8 2531 2972 14636819 14636383 2.220000e-121 446.0
42 TraesCS6A01G049700 chr3D 91.045 201 15 3 85 285 441025616 441025813 5.150000e-68 268.0
43 TraesCS6A01G049700 chr2B 88.000 225 24 3 2176 2400 756018165 756018386 2.400000e-66 263.0
44 TraesCS6A01G049700 chr2B 81.579 152 17 8 2176 2322 699613564 699613419 7.100000e-22 115.0
45 TraesCS6A01G049700 chr1A 88.406 138 14 2 2998 3134 52544025 52543889 6.950000e-37 165.0
46 TraesCS6A01G049700 chr7B 84.354 147 16 7 350 492 712740716 712740573 1.520000e-28 137.0
47 TraesCS6A01G049700 chr3A 84.615 117 18 0 3001 3117 14294060 14294176 1.970000e-22 117.0
48 TraesCS6A01G049700 chr3A 92.308 78 4 1 1 78 472418347 472418422 3.300000e-20 110.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G049700 chr6A 25524703 25527836 3133 False 5788.00 5788 100.000000 1 3134 1 chr6A.!!$F5 3133
1 TraesCS6A01G049700 chr6A 25106445 25108878 2433 False 3936.00 3936 95.642000 1 2476 1 chr6A.!!$F2 2475
2 TraesCS6A01G049700 chr6A 25069687 25071568 1881 False 2844.00 2844 93.841000 276 2181 1 chr6A.!!$F1 1905
3 TraesCS6A01G049700 chr6A 25202392 25204896 2504 False 2020.00 2503 93.045500 1 2476 2 chr6A.!!$F7 2475
4 TraesCS6A01G049700 chr6A 25471769 25474867 3098 False 1700.00 3524 97.350000 1 3134 3 chr6A.!!$F10 3133
5 TraesCS6A01G049700 chr6A 25407483 25410509 3026 False 1419.00 2531 98.551333 1 3134 3 chr6A.!!$F9 3133
6 TraesCS6A01G049700 chr6A 25580106 25583185 3079 False 1314.00 2045 96.329000 1 3134 4 chr6A.!!$F11 3133
7 TraesCS6A01G049700 chr6A 25313175 25316617 3442 False 1274.75 3712 97.150250 1 3134 4 chr6A.!!$F8 3133
8 TraesCS6A01G049700 chr6A 25213423 25214079 656 False 1094.00 1094 96.662000 2476 3134 1 chr6A.!!$F4 658
9 TraesCS6A01G049700 chr6A 25137648 25138301 653 False 1062.00 1062 95.903000 2476 3134 1 chr6A.!!$F3 658
10 TraesCS6A01G049700 chrUn 94315886 94317572 1686 False 2409.00 2409 92.551000 483 2166 1 chrUn.!!$F3 1683
11 TraesCS6A01G049700 chrUn 94279963 94281627 1664 False 2399.00 2399 92.617000 483 2166 1 chrUn.!!$F2 1683
12 TraesCS6A01G049700 chrUn 94399208 94400878 1670 False 2355.00 2355 92.062000 483 2166 1 chrUn.!!$F5 1683
13 TraesCS6A01G049700 chrUn 94374281 94375921 1640 False 2344.00 2344 92.221000 483 2166 1 chrUn.!!$F4 1683
14 TraesCS6A01G049700 chrUn 94456416 94458053 1637 False 2337.00 2337 92.162000 483 2166 1 chrUn.!!$F6 1683
15 TraesCS6A01G049700 chrUn 325489338 325491020 1682 True 2305.00 2305 91.525000 483 2166 1 chrUn.!!$R1 1683
16 TraesCS6A01G049700 chrUn 94214509 94215745 1236 False 1570.00 1570 89.482000 899 2166 1 chrUn.!!$F1 1267
17 TraesCS6A01G049700 chrUn 355223290 355224192 902 False 1266.00 1266 91.996000 1261 2166 1 chrUn.!!$F8 905
18 TraesCS6A01G049700 chrUn 284307042 284307941 899 False 1253.00 1253 91.776000 1261 2166 1 chrUn.!!$F7 905
19 TraesCS6A01G049700 chr6B 43384163 43385443 1280 False 1628.00 1628 89.829000 899 2166 1 chr6B.!!$F1 1267
20 TraesCS6A01G049700 chr6B 43436239 43437492 1253 False 1554.00 1554 89.037000 899 2166 1 chr6B.!!$F2 1267
21 TraesCS6A01G049700 chr6B 43474871 43475673 802 False 1005.00 1005 89.370000 899 1699 1 chr6B.!!$F3 800
22 TraesCS6A01G049700 chr4D 495449954 495451414 1460 True 534.00 833 95.720667 2175 3006 3 chr4D.!!$R2 831

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
820 894 6.482641 AGTGAATAAGATGAGTCATGCATGTC 59.517 38.462 25.43 20.17 0.00 3.06 F
1460 1654 0.315886 CCAATTTCACAGCAGCAGCA 59.684 50.000 3.17 0.00 45.49 4.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1767 2180 0.333312 AGGAGACCTGACTCGATGGT 59.667 55.000 0.0 0.0 37.74 3.55 R
2329 3285 2.119611 TCGTTGGAGGCCCAGAGA 59.880 61.111 0.0 0.0 44.60 3.10 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
496 567 8.973378 GTAGATGACTAGTGATTACAATCTTGC 58.027 37.037 0.00 0.00 36.39 4.01
689 763 7.224297 ACAGACCACACAAGATTACAAACTAT 58.776 34.615 0.00 0.00 0.00 2.12
820 894 6.482641 AGTGAATAAGATGAGTCATGCATGTC 59.517 38.462 25.43 20.17 0.00 3.06
1221 1296 0.803117 CATCTCAGCAACAGCCACAG 59.197 55.000 0.00 0.00 0.00 3.66
1234 1309 1.239968 GCCACAGGAGCAAGTTCCAG 61.240 60.000 5.74 0.00 39.84 3.86
1388 1568 0.821301 TCGCAGCCACAACCATTTCA 60.821 50.000 0.00 0.00 0.00 2.69
1453 1647 2.865551 CCACAACAACCAATTTCACAGC 59.134 45.455 0.00 0.00 0.00 4.40
1454 1648 3.519579 CACAACAACCAATTTCACAGCA 58.480 40.909 0.00 0.00 0.00 4.41
1455 1649 3.552699 CACAACAACCAATTTCACAGCAG 59.447 43.478 0.00 0.00 0.00 4.24
1456 1650 2.514205 ACAACCAATTTCACAGCAGC 57.486 45.000 0.00 0.00 0.00 5.25
1457 1651 1.755959 ACAACCAATTTCACAGCAGCA 59.244 42.857 0.00 0.00 0.00 4.41
1458 1652 2.223876 ACAACCAATTTCACAGCAGCAG 60.224 45.455 0.00 0.00 0.00 4.24
1459 1653 0.316204 ACCAATTTCACAGCAGCAGC 59.684 50.000 0.00 0.00 42.56 5.25
1460 1654 0.315886 CCAATTTCACAGCAGCAGCA 59.684 50.000 3.17 0.00 45.49 4.41
1461 1655 1.668919 CCAATTTCACAGCAGCAGCAG 60.669 52.381 3.17 0.00 45.49 4.24
1514 1759 4.271291 ACAACAACAACAACAACAACAACC 59.729 37.500 0.00 0.00 0.00 3.77
1757 2170 6.422776 ACAAAAACAACAACAACAACAACA 57.577 29.167 0.00 0.00 0.00 3.33
1758 2171 6.842163 ACAAAAACAACAACAACAACAACAA 58.158 28.000 0.00 0.00 0.00 2.83
1759 2172 6.743172 ACAAAAACAACAACAACAACAACAAC 59.257 30.769 0.00 0.00 0.00 3.32
1760 2173 6.422776 AAAACAACAACAACAACAACAACA 57.577 29.167 0.00 0.00 0.00 3.33
1761 2174 6.422776 AAACAACAACAACAACAACAACAA 57.577 29.167 0.00 0.00 0.00 2.83
1762 2175 5.396750 ACAACAACAACAACAACAACAAC 57.603 34.783 0.00 0.00 0.00 3.32
1763 2176 4.870426 ACAACAACAACAACAACAACAACA 59.130 33.333 0.00 0.00 0.00 3.33
1764 2177 5.351465 ACAACAACAACAACAACAACAACAA 59.649 32.000 0.00 0.00 0.00 2.83
1765 2178 5.396750 ACAACAACAACAACAACAACAAC 57.603 34.783 0.00 0.00 0.00 3.32
1766 2179 4.870426 ACAACAACAACAACAACAACAACA 59.130 33.333 0.00 0.00 0.00 3.33
1767 2180 5.351465 ACAACAACAACAACAACAACAACAA 59.649 32.000 0.00 0.00 0.00 2.83
1768 2181 5.396750 ACAACAACAACAACAACAACAAC 57.603 34.783 0.00 0.00 0.00 3.32
1776 2189 3.013921 ACAACAACAACAACCATCGAGT 58.986 40.909 0.00 0.00 0.00 4.18
2172 2591 9.035607 CACAGGTCTTGTCTACATATTTATGTC 57.964 37.037 6.49 0.00 41.09 3.06
2271 2696 8.926092 AATTAGAAATTACTAGCCCTCAATCC 57.074 34.615 0.00 0.00 0.00 3.01
2779 4215 4.759693 ACGTTCATGCACTTGGAAAATAGA 59.240 37.500 0.00 0.00 0.00 1.98
2780 4216 5.240623 ACGTTCATGCACTTGGAAAATAGAA 59.759 36.000 0.00 0.00 0.00 2.10
3070 4513 2.036006 AGCGCGGCCGTTTGATTAA 61.036 52.632 28.70 0.00 36.67 1.40
3093 4536 7.624360 AAATTGCATTTAACCGTCAGATCTA 57.376 32.000 0.00 0.00 0.00 1.98
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
278 279 3.689872 AGAGTGCCTCTACTTCCCATA 57.310 47.619 3.19 0.0 39.28 2.74
689 763 1.375396 GCATGGCTGTCACGGTACA 60.375 57.895 0.00 0.0 0.00 2.90
1221 1296 1.071699 TGTACCACTGGAACTTGCTCC 59.928 52.381 0.71 0.0 35.88 4.70
1234 1309 6.915843 CCTAGAAATTGTTGTTGTTGTACCAC 59.084 38.462 0.00 0.0 0.00 4.16
1388 1568 3.838565 TGTGGATATGGTTGTTGTGGTT 58.161 40.909 0.00 0.0 0.00 3.67
1514 1759 7.218583 GCAAAATTTGTTGAAGGATTTGTTGTG 59.781 33.333 7.60 0.0 0.00 3.33
1757 2170 3.275143 TGACTCGATGGTTGTTGTTGTT 58.725 40.909 0.00 0.0 0.00 2.83
1758 2171 2.872245 CTGACTCGATGGTTGTTGTTGT 59.128 45.455 0.00 0.0 0.00 3.32
1759 2172 2.224079 CCTGACTCGATGGTTGTTGTTG 59.776 50.000 0.00 0.0 0.00 3.33
1760 2173 2.158813 ACCTGACTCGATGGTTGTTGTT 60.159 45.455 0.00 0.0 0.00 2.83
1761 2174 1.416401 ACCTGACTCGATGGTTGTTGT 59.584 47.619 0.00 0.0 0.00 3.32
1762 2175 2.069273 GACCTGACTCGATGGTTGTTG 58.931 52.381 0.00 0.0 33.74 3.33
1763 2176 1.971357 AGACCTGACTCGATGGTTGTT 59.029 47.619 0.00 0.0 33.74 2.83
1764 2177 1.546476 GAGACCTGACTCGATGGTTGT 59.454 52.381 0.00 0.0 33.74 3.32
1765 2178 1.134965 GGAGACCTGACTCGATGGTTG 60.135 57.143 0.00 0.0 37.74 3.77
1766 2179 1.187087 GGAGACCTGACTCGATGGTT 58.813 55.000 0.00 0.0 37.74 3.67
1767 2180 0.333312 AGGAGACCTGACTCGATGGT 59.667 55.000 0.00 0.0 37.74 3.55
1768 2181 1.407258 GAAGGAGACCTGACTCGATGG 59.593 57.143 0.00 0.0 37.74 3.51
1776 2189 0.687354 GCTGTTGGAAGGAGACCTGA 59.313 55.000 0.00 0.0 32.13 3.86
2329 3285 2.119611 TCGTTGGAGGCCCAGAGA 59.880 61.111 0.00 0.0 44.60 3.10
3070 4513 7.047891 TCTAGATCTGACGGTTAAATGCAATT 58.952 34.615 5.18 0.0 38.98 2.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.