Multiple sequence alignment - TraesCS6A01G049600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G049600 chr6A 100.000 3104 0 0 1 3104 25471736 25474839 0.000000e+00 5733
1 TraesCS6A01G049600 chr6A 97.717 3110 40 7 1 3104 25580073 25583157 0.000000e+00 5321
2 TraesCS6A01G049600 chr6A 96.383 2184 64 5 287 2468 25106730 25108900 0.000000e+00 3581
3 TraesCS6A01G049600 chr6A 95.936 2190 59 5 287 2446 25524989 25527178 0.000000e+00 3524
4 TraesCS6A01G049600 chr6A 96.489 2136 49 9 985 3102 25408352 25410479 0.000000e+00 3506
5 TraesCS6A01G049600 chr6A 97.613 1969 38 1 287 2255 25313460 25315419 0.000000e+00 3367
6 TraesCS6A01G049600 chr6A 93.594 1889 78 8 287 2151 25069699 25071568 0.000000e+00 2778
7 TraesCS6A01G049600 chr6A 96.549 1217 34 2 287 1501 25202678 25203888 0.000000e+00 2008
8 TraesCS6A01G049600 chr6A 89.644 1236 91 25 1262 2465 25203685 25204915 0.000000e+00 1539
9 TraesCS6A01G049600 chr6A 93.690 935 31 17 1 933 25407450 25408358 0.000000e+00 1375
10 TraesCS6A01G049600 chr6A 97.306 631 12 4 2475 3102 25527178 25527806 0.000000e+00 1066
11 TraesCS6A01G049600 chr6A 95.956 643 21 5 2464 3104 25213412 25214051 0.000000e+00 1038
12 TraesCS6A01G049600 chr6A 95.950 642 20 4 2464 3104 25137637 25138273 0.000000e+00 1037
13 TraesCS6A01G049600 chr6A 99.070 430 3 1 2288 2716 25315421 25315850 0.000000e+00 771
14 TraesCS6A01G049600 chr6A 97.954 391 6 2 2716 3104 25316199 25316589 0.000000e+00 676
15 TraesCS6A01G049600 chr6A 98.969 291 3 0 1 291 25524670 25524960 3.550000e-144 521
16 TraesCS6A01G049600 chr6A 98.282 291 5 0 1 291 25313142 25313432 7.680000e-141 510
17 TraesCS6A01G049600 chr6A 96.907 291 8 1 1 291 25106412 25106701 1.290000e-133 486
18 TraesCS6A01G049600 chr6A 96.564 291 10 0 1 291 25202359 25202649 1.670000e-132 483
19 TraesCS6A01G049600 chr6A 90.090 111 7 2 1 111 565053010 565053116 1.160000e-29 141
20 TraesCS6A01G049600 chrUn 93.470 1654 95 3 483 2136 94374281 94375921 0.000000e+00 2444
21 TraesCS6A01G049600 chrUn 93.410 1654 93 6 483 2136 94456416 94458053 0.000000e+00 2436
22 TraesCS6A01G049600 chrUn 92.014 1678 97 7 483 2136 94279963 94281627 0.000000e+00 2322
23 TraesCS6A01G049600 chrUn 91.895 1678 96 8 483 2136 325949665 325951326 0.000000e+00 2309
24 TraesCS6A01G049600 chrUn 91.226 1664 122 14 483 2136 94431429 94433078 0.000000e+00 2242
25 TraesCS6A01G049600 chr6B 88.651 1260 115 15 899 2136 43436239 43437492 0.000000e+00 1509
26 TraesCS6A01G049600 chr6B 90.090 111 7 2 1 111 558917768 558917874 1.160000e-29 141
27 TraesCS6A01G049600 chr4D 93.228 635 26 9 2385 3004 495450586 495449954 0.000000e+00 918
28 TraesCS6A01G049600 chr4D 95.436 241 7 3 2151 2389 495450877 495450639 6.280000e-102 381
29 TraesCS6A01G049600 chr4D 95.671 231 10 0 2145 2375 495451414 495451184 3.780000e-99 372
30 TraesCS6A01G049600 chr4D 90.643 171 16 0 121 291 105123154 105122984 8.660000e-56 228
31 TraesCS6A01G049600 chr5B 85.459 447 54 8 2528 2974 658338331 658338766 3.650000e-124 455
32 TraesCS6A01G049600 chr5B 92.308 169 12 1 123 291 659093900 659094067 4.000000e-59 239
33 TraesCS6A01G049600 chr7D 83.789 475 62 12 2529 2996 14636819 14636353 1.320000e-118 436
34 TraesCS6A01G049600 chr2B 88.000 225 24 3 2146 2370 756018165 756018386 2.370000e-66 263
35 TraesCS6A01G049600 chr3D 90.805 174 13 3 118 291 441025616 441025786 2.410000e-56 230
36 TraesCS6A01G049600 chr7A 93.137 102 7 0 3003 3104 634608247 634608146 1.930000e-32 150
37 TraesCS6A01G049600 chr3A 90.090 111 7 2 1 111 472418316 472418422 1.160000e-29 141


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G049600 chr6A 25471736 25474839 3103 False 5733.000000 5733 100.000000 1 3104 1 chr6A.!!$F4 3103
1 TraesCS6A01G049600 chr6A 25580073 25583157 3084 False 5321.000000 5321 97.717000 1 3104 1 chr6A.!!$F5 3103
2 TraesCS6A01G049600 chr6A 25069699 25071568 1869 False 2778.000000 2778 93.594000 287 2151 1 chr6A.!!$F1 1864
3 TraesCS6A01G049600 chr6A 25407450 25410479 3029 False 2440.500000 3506 95.089500 1 3102 2 chr6A.!!$F10 3101
4 TraesCS6A01G049600 chr6A 25106412 25108900 2488 False 2033.500000 3581 96.645000 1 2468 2 chr6A.!!$F7 2467
5 TraesCS6A01G049600 chr6A 25524670 25527806 3136 False 1703.666667 3524 97.403667 1 3102 3 chr6A.!!$F11 3101
6 TraesCS6A01G049600 chr6A 25202359 25204915 2556 False 1343.333333 2008 94.252333 1 2465 3 chr6A.!!$F8 2464
7 TraesCS6A01G049600 chr6A 25313142 25316589 3447 False 1331.000000 3367 98.229750 1 3104 4 chr6A.!!$F9 3103
8 TraesCS6A01G049600 chr6A 25213412 25214051 639 False 1038.000000 1038 95.956000 2464 3104 1 chr6A.!!$F3 640
9 TraesCS6A01G049600 chr6A 25137637 25138273 636 False 1037.000000 1037 95.950000 2464 3104 1 chr6A.!!$F2 640
10 TraesCS6A01G049600 chrUn 94374281 94375921 1640 False 2444.000000 2444 93.470000 483 2136 1 chrUn.!!$F2 1653
11 TraesCS6A01G049600 chrUn 94456416 94458053 1637 False 2436.000000 2436 93.410000 483 2136 1 chrUn.!!$F4 1653
12 TraesCS6A01G049600 chrUn 94279963 94281627 1664 False 2322.000000 2322 92.014000 483 2136 1 chrUn.!!$F1 1653
13 TraesCS6A01G049600 chrUn 325949665 325951326 1661 False 2309.000000 2309 91.895000 483 2136 1 chrUn.!!$F5 1653
14 TraesCS6A01G049600 chrUn 94431429 94433078 1649 False 2242.000000 2242 91.226000 483 2136 1 chrUn.!!$F3 1653
15 TraesCS6A01G049600 chr6B 43436239 43437492 1253 False 1509.000000 1509 88.651000 899 2136 1 chr6B.!!$F1 1237
16 TraesCS6A01G049600 chr4D 495449954 495451414 1460 True 557.000000 918 94.778333 2145 3004 3 chr4D.!!$R2 859

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
518 556 5.298026 TGTTTGTGTGCAAGTCAAGCTTATA 59.702 36.0 0.0 0.0 35.27 0.98 F
1133 1175 0.625849 TTTCTCATCCTTGCCCTCCC 59.374 55.0 0.0 0.0 0.00 4.30 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1752 1982 0.957888 GCAGAGGCTGTTGGAAGGAC 60.958 60.000 0.00 0.0 36.96 3.85 R
2230 2472 2.398588 AGATTTACCAGATCGAGGGCA 58.601 47.619 11.27 0.0 0.00 5.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
518 556 5.298026 TGTTTGTGTGCAAGTCAAGCTTATA 59.702 36.000 0.00 0.00 35.27 0.98
586 624 9.026074 GCTTGCTAATAACTTCTAGAACACTAG 57.974 37.037 0.00 0.00 36.06 2.57
1025 1067 2.050754 ATAGCCCCATAGCATGAGGT 57.949 50.000 0.00 0.00 29.64 3.85
1048 1090 5.658198 TCATCCTTCCTCATCCATCATTT 57.342 39.130 0.00 0.00 0.00 2.32
1133 1175 0.625849 TTTCTCATCCTTGCCCTCCC 59.374 55.000 0.00 0.00 0.00 4.30
1501 1599 6.128282 ACAACAACAACAACAACAACAACAAA 60.128 30.769 0.00 0.00 0.00 2.83
1503 1601 6.481984 ACAACAACAACAACAACAACAAAAG 58.518 32.000 0.00 0.00 0.00 2.27
1674 1835 2.341543 CCTGAGCAGTCGCAGTGT 59.658 61.111 0.00 0.00 42.27 3.55
1752 1982 0.606401 AACAACCATCGAGCCAGGTG 60.606 55.000 2.88 0.00 35.42 4.00
1892 2122 2.074729 AGGAACCTAGCGCTACAGAT 57.925 50.000 14.45 2.36 0.00 2.90
1935 2171 3.973305 TCTACATCCCTCCATATTGCACA 59.027 43.478 0.00 0.00 0.00 4.57
2040 2276 2.147958 TGGTTTGGTCATTGTAGCGTC 58.852 47.619 0.00 0.00 0.00 5.19
2347 3120 4.869861 TGACACATCTGAACGAACATATGG 59.130 41.667 7.80 0.00 31.61 2.74
2960 4163 7.283127 ACATTGTTTGGCTATAGTATGAACCTG 59.717 37.037 0.84 5.52 0.00 4.00
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
518 556 9.748708 TTCTACAAGTTGTTACGTGTAAACTAT 57.251 29.630 14.90 0.45 44.68 2.12
586 624 8.755018 CAAATTCCTTTTACATGTCAAGTGTTC 58.245 33.333 0.00 0.00 0.00 3.18
751 792 7.748847 TCTAGATTGCGTATTTTTCTGAAACC 58.251 34.615 1.58 0.00 0.00 3.27
1023 1065 3.137176 TGATGGATGAGGAAGGATGAACC 59.863 47.826 0.00 0.00 39.35 3.62
1025 1067 5.658198 AATGATGGATGAGGAAGGATGAA 57.342 39.130 0.00 0.00 0.00 2.57
1048 1090 7.307396 GCTTAAATGATGCGCTCTACTAATGAA 60.307 37.037 9.73 0.00 0.00 2.57
1133 1175 1.878522 GTGGTCGCCACGATAGCAG 60.879 63.158 12.22 0.00 44.95 4.24
1501 1599 6.095160 TGCAAAATTTGTTGAAGGATTTGCTT 59.905 30.769 17.71 0.00 46.73 3.91
1503 1601 5.819059 TGCAAAATTTGTTGAAGGATTTGC 58.181 33.333 7.60 12.03 46.77 3.68
1674 1835 2.607499 ACAACATTTTGGATGGCCTGA 58.393 42.857 3.32 0.00 37.00 3.86
1752 1982 0.957888 GCAGAGGCTGTTGGAAGGAC 60.958 60.000 0.00 0.00 36.96 3.85
2230 2472 2.398588 AGATTTACCAGATCGAGGGCA 58.601 47.619 11.27 0.00 0.00 5.36
2285 3058 7.420680 GGAGGCCCAGAGCATTATATATGTTAT 60.421 40.741 0.00 0.00 46.50 1.89


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.