Multiple sequence alignment - TraesCS6A01G049200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G049200 chr6A 100.000 3161 0 0 1 3161 25202388 25205548 0.000000e+00 5838.0
1 TraesCS6A01G049200 chr6A 92.275 1864 106 23 1318 3161 25107687 25109532 0.000000e+00 2610.0
2 TraesCS6A01G049200 chr6A 97.335 1501 32 3 1 1495 25106441 25107939 0.000000e+00 2543.0
3 TraesCS6A01G049200 chr6A 96.401 1528 47 2 1 1522 25524699 25526224 0.000000e+00 2510.0
4 TraesCS6A01G049200 chr6A 96.676 1504 41 3 1 1498 25313171 25314671 0.000000e+00 2492.0
5 TraesCS6A01G049200 chr6A 96.549 1217 34 2 291 1501 25472022 25473236 0.000000e+00 2008.0
6 TraesCS6A01G049200 chr6A 96.747 1199 31 2 291 1483 25580359 25581555 0.000000e+00 1991.0
7 TraesCS6A01G049200 chr6A 94.276 1223 55 5 280 1489 25069687 25070907 0.000000e+00 1857.0
8 TraesCS6A01G049200 chr6A 89.644 1236 91 25 1298 2528 25472997 25474200 0.000000e+00 1539.0
9 TraesCS6A01G049200 chr6A 89.811 1217 100 14 1318 2528 25581315 25582513 0.000000e+00 1539.0
10 TraesCS6A01G049200 chr6A 89.700 1233 88 18 1298 2509 25525964 25527178 0.000000e+00 1537.0
11 TraesCS6A01G049200 chr6A 89.343 1248 81 28 1298 2528 25408629 25409841 0.000000e+00 1520.0
12 TraesCS6A01G049200 chr6A 88.454 1022 79 24 1318 2318 25314416 25315419 0.000000e+00 1197.0
13 TraesCS6A01G049200 chr6A 95.597 636 26 2 2528 3161 25212197 25212832 0.000000e+00 1018.0
14 TraesCS6A01G049200 chr6A 94.231 572 24 3 369 933 25407789 25408358 0.000000e+00 865.0
15 TraesCS6A01G049200 chr6A 95.793 309 13 0 1 309 25407479 25407787 1.690000e-137 499.0
16 TraesCS6A01G049200 chr6A 96.183 262 10 0 1 262 25471765 25472026 2.250000e-116 429.0
17 TraesCS6A01G049200 chr6A 96.154 260 10 0 3 262 25580104 25580363 2.910000e-115 425.0
18 TraesCS6A01G049200 chr6A 96.629 178 6 0 2351 2528 25315421 25315598 2.380000e-76 296.0
19 TraesCS6A01G049200 chr6A 90.909 88 7 1 2187 2273 24922847 24922934 1.990000e-22 117.0
20 TraesCS6A01G049200 chr6A 92.958 71 3 2 2205 2273 25484976 25485046 5.580000e-18 102.0
21 TraesCS6A01G049200 chr6A 95.312 64 2 1 2205 2267 25335284 25335347 2.010000e-17 100.0
22 TraesCS6A01G049200 chr6A 95.161 62 2 1 2205 2265 25415914 25415975 2.600000e-16 97.1
23 TraesCS6A01G049200 chr6A 95.161 62 2 1 2205 2265 25532505 25532566 2.600000e-16 97.1
24 TraesCS6A01G049200 chr6A 92.537 67 4 1 2208 2273 25219468 25219534 9.330000e-16 95.3
25 TraesCS6A01G049200 chr6A 86.364 88 9 3 1 87 565053037 565053122 3.360000e-15 93.5
26 TraesCS6A01G049200 chr6A 90.141 71 5 2 2205 2273 25593573 25593643 1.210000e-14 91.6
27 TraesCS6A01G049200 chrUn 91.146 1728 115 19 487 2193 284306231 284307941 0.000000e+00 2309.0
28 TraesCS6A01G049200 chrUn 90.809 1719 114 21 487 2193 94315886 94317572 0.000000e+00 2259.0
29 TraesCS6A01G049200 chrUn 94.083 1014 51 3 487 1494 94374281 94375291 0.000000e+00 1531.0
30 TraesCS6A01G049200 chrUn 93.793 1015 54 3 487 1495 94279963 94280974 0.000000e+00 1517.0
31 TraesCS6A01G049200 chrUn 91.690 1083 78 5 487 1560 94590733 94591812 0.000000e+00 1491.0
32 TraesCS6A01G049200 chrUn 90.675 1126 75 16 1086 2193 355223079 355224192 0.000000e+00 1471.0
33 TraesCS6A01G049200 chrUn 91.837 1029 54 5 487 1488 94345235 94346260 0.000000e+00 1408.0
34 TraesCS6A01G049200 chrUn 87.622 921 93 15 1279 2193 325950421 325951326 0.000000e+00 1050.0
35 TraesCS6A01G049200 chrUn 88.027 877 73 18 1333 2193 94457193 94458053 0.000000e+00 1009.0
36 TraesCS6A01G049200 chrUn 87.886 875 81 15 1333 2193 94375058 94375921 0.000000e+00 1005.0
37 TraesCS6A01G049200 chrUn 93.827 81 5 0 2187 2267 94593060 94593140 4.280000e-24 122.0
38 TraesCS6A01G049200 chrUn 92.045 88 6 1 2187 2273 229105388 229105475 4.280000e-24 122.0
39 TraesCS6A01G049200 chr4A 95.788 641 18 4 2529 3161 529271442 529272081 0.000000e+00 1026.0
40 TraesCS6A01G049200 chr4A 95.298 638 22 3 2532 3161 529257225 529257862 0.000000e+00 1005.0
41 TraesCS6A01G049200 chr7A 95.455 638 21 3 2532 3161 547917853 547917216 0.000000e+00 1011.0
42 TraesCS6A01G049200 chr7A 94.984 638 24 3 2532 3161 103525136 103524499 0.000000e+00 994.0
43 TraesCS6A01G049200 chr5A 95.133 637 23 3 2532 3160 198212264 198211628 0.000000e+00 998.0
44 TraesCS6A01G049200 chr5A 94.984 638 24 3 2532 3161 158845491 158846128 0.000000e+00 994.0
45 TraesCS6A01G049200 chr5A 94.852 641 25 5 2528 3160 198206354 198205714 0.000000e+00 994.0
46 TraesCS6A01G049200 chr6B 86.918 902 89 16 1304 2193 43436608 43437492 0.000000e+00 985.0
47 TraesCS6A01G049200 chr6B 92.593 81 6 0 2187 2267 43385516 43385596 1.990000e-22 117.0
48 TraesCS6A01G049200 chr6B 92.593 81 6 0 2187 2267 43437565 43437645 1.990000e-22 117.0
49 TraesCS6A01G049200 chr6B 92.593 81 6 0 2187 2267 43476558 43476638 1.990000e-22 117.0
50 TraesCS6A01G049200 chr6B 92.593 81 6 0 2187 2267 43481954 43482034 1.990000e-22 117.0
51 TraesCS6A01G049200 chr6B 88.000 100 8 4 2187 2284 62654932 62655029 7.160000e-22 115.0
52 TraesCS6A01G049200 chr6B 89.773 88 7 2 2187 2273 43895730 43895816 9.270000e-21 111.0
53 TraesCS6A01G049200 chr6B 89.773 88 7 2 2187 2273 43923895 43923981 9.270000e-21 111.0
54 TraesCS6A01G049200 chr6B 86.364 88 9 3 1 87 558917795 558917880 3.360000e-15 93.5
55 TraesCS6A01G049200 chr4D 95.055 182 9 0 2271 2452 495450820 495450639 1.430000e-73 287.0
56 TraesCS6A01G049200 chr4D 94.643 168 9 0 2271 2438 495451351 495451184 8.700000e-66 261.0
57 TraesCS6A01G049200 chr4D 90.206 194 19 0 92 285 105123154 105122961 1.460000e-63 254.0
58 TraesCS6A01G049200 chr7D 89.340 197 19 2 89 285 497318686 497318880 2.440000e-61 246.0
59 TraesCS6A01G049200 chr3D 89.055 201 19 3 89 289 441025616 441025813 2.440000e-61 246.0
60 TraesCS6A01G049200 chr2B 86.747 166 20 2 2268 2433 756018223 756018386 1.940000e-42 183.0
61 TraesCS6A01G049200 chr7B 84.615 143 16 3 354 492 712740716 712740576 1.530000e-28 137.0
62 TraesCS6A01G049200 chr3A 89.655 87 6 3 2 87 472418344 472418428 1.200000e-19 108.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G049200 chr6A 25202388 25205548 3160 False 5838.000000 5838 100.000000 1 3161 1 chr6A.!!$F3 3160
1 TraesCS6A01G049200 chr6A 25106441 25109532 3091 False 2576.500000 2610 94.805000 1 3161 2 chr6A.!!$F12 3160
2 TraesCS6A01G049200 chr6A 25524699 25527178 2479 False 2023.500000 2510 93.050500 1 2509 2 chr6A.!!$F16 2508
3 TraesCS6A01G049200 chr6A 25069687 25070907 1220 False 1857.000000 1857 94.276000 280 1489 1 chr6A.!!$F2 1209
4 TraesCS6A01G049200 chr6A 25313171 25315598 2427 False 1328.333333 2492 93.919667 1 2528 3 chr6A.!!$F13 2527
5 TraesCS6A01G049200 chr6A 25471765 25474200 2435 False 1325.333333 2008 94.125333 1 2528 3 chr6A.!!$F15 2527
6 TraesCS6A01G049200 chr6A 25580104 25582513 2409 False 1318.333333 1991 94.237333 3 2528 3 chr6A.!!$F17 2525
7 TraesCS6A01G049200 chr6A 25212197 25212832 635 False 1018.000000 1018 95.597000 2528 3161 1 chr6A.!!$F4 633
8 TraesCS6A01G049200 chr6A 25407479 25409841 2362 False 961.333333 1520 93.122333 1 2528 3 chr6A.!!$F14 2527
9 TraesCS6A01G049200 chrUn 284306231 284307941 1710 False 2309.000000 2309 91.146000 487 2193 1 chrUn.!!$F6 1706
10 TraesCS6A01G049200 chrUn 94315886 94317572 1686 False 2259.000000 2259 90.809000 487 2193 1 chrUn.!!$F2 1706
11 TraesCS6A01G049200 chrUn 94279963 94280974 1011 False 1517.000000 1517 93.793000 487 1495 1 chrUn.!!$F1 1008
12 TraesCS6A01G049200 chrUn 355223079 355224192 1113 False 1471.000000 1471 90.675000 1086 2193 1 chrUn.!!$F8 1107
13 TraesCS6A01G049200 chrUn 94345235 94346260 1025 False 1408.000000 1408 91.837000 487 1488 1 chrUn.!!$F3 1001
14 TraesCS6A01G049200 chrUn 94374281 94375921 1640 False 1268.000000 1531 90.984500 487 2193 2 chrUn.!!$F9 1706
15 TraesCS6A01G049200 chrUn 325950421 325951326 905 False 1050.000000 1050 87.622000 1279 2193 1 chrUn.!!$F7 914
16 TraesCS6A01G049200 chrUn 94457193 94458053 860 False 1009.000000 1009 88.027000 1333 2193 1 chrUn.!!$F4 860
17 TraesCS6A01G049200 chrUn 94590733 94593140 2407 False 806.500000 1491 92.758500 487 2267 2 chrUn.!!$F10 1780
18 TraesCS6A01G049200 chr4A 529271442 529272081 639 False 1026.000000 1026 95.788000 2529 3161 1 chr4A.!!$F2 632
19 TraesCS6A01G049200 chr4A 529257225 529257862 637 False 1005.000000 1005 95.298000 2532 3161 1 chr4A.!!$F1 629
20 TraesCS6A01G049200 chr7A 547917216 547917853 637 True 1011.000000 1011 95.455000 2532 3161 1 chr7A.!!$R2 629
21 TraesCS6A01G049200 chr7A 103524499 103525136 637 True 994.000000 994 94.984000 2532 3161 1 chr7A.!!$R1 629
22 TraesCS6A01G049200 chr5A 198211628 198212264 636 True 998.000000 998 95.133000 2532 3160 1 chr5A.!!$R2 628
23 TraesCS6A01G049200 chr5A 158845491 158846128 637 False 994.000000 994 94.984000 2532 3161 1 chr5A.!!$F1 629
24 TraesCS6A01G049200 chr5A 198205714 198206354 640 True 994.000000 994 94.852000 2528 3160 1 chr5A.!!$R1 632
25 TraesCS6A01G049200 chr6B 43436608 43437645 1037 False 551.000000 985 89.755500 1304 2267 2 chr6B.!!$F8 963
26 TraesCS6A01G049200 chr4D 495450639 495451351 712 True 274.000000 287 94.849000 2271 2452 2 chr4D.!!$R2 181

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
552 590 4.678287 ACACGTAACAACTCGTAGAACATG 59.322 41.667 0.0 0.0 38.52 3.21 F
1433 1623 1.535462 GCAACCACAGTATTCGCAACT 59.465 47.619 0.0 0.0 0.00 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1614 2461 0.238289 GCGCTATGTTGTGTTGCTGT 59.762 50.0 0.00 0.00 0.00 4.40 R
2647 3612 0.962356 ATCTTTCTGTGCCGGCAAGG 60.962 55.0 34.66 25.87 44.97 3.61 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
222 223 9.114952 TGAAATAATTATTACCAGATGCGTGAA 57.885 29.630 11.07 0.00 0.00 3.18
494 532 5.531659 ACGGGTAGATGACTAGTGATTACAG 59.468 44.000 0.00 4.54 0.00 2.74
542 580 8.582096 GCTTATCTAGTTTACACGTAACAACTC 58.418 37.037 8.30 0.00 0.00 3.01
552 590 4.678287 ACACGTAACAACTCGTAGAACATG 59.322 41.667 0.00 0.00 38.52 3.21
695 742 6.982141 CACACAAGACTACAAACTAAGTACCA 59.018 38.462 0.00 0.00 0.00 3.25
1060 1107 8.591940 CCTCATCCATCATTCTCATAAGTAGAA 58.408 37.037 0.00 0.00 37.38 2.10
1083 1130 3.192466 GCATCATTTAAGCCAAGCAAGG 58.808 45.455 0.00 0.00 0.00 3.61
1433 1623 1.535462 GCAACCACAGTATTCGCAACT 59.465 47.619 0.00 0.00 0.00 3.16
1505 2080 4.870426 ACAACAACAACAACAACAACAACA 59.130 33.333 0.00 0.00 0.00 3.33
1506 2081 5.351465 ACAACAACAACAACAACAACAACAA 59.649 32.000 0.00 0.00 0.00 2.83
1507 2082 5.396750 ACAACAACAACAACAACAACAAC 57.603 34.783 0.00 0.00 0.00 3.32
1508 2083 4.870426 ACAACAACAACAACAACAACAACA 59.130 33.333 0.00 0.00 0.00 3.33
1509 2084 5.351465 ACAACAACAACAACAACAACAACAA 59.649 32.000 0.00 0.00 0.00 2.83
1510 2085 5.396750 ACAACAACAACAACAACAACAAC 57.603 34.783 0.00 0.00 0.00 3.32
1511 2086 4.870426 ACAACAACAACAACAACAACAACA 59.130 33.333 0.00 0.00 0.00 3.33
1512 2087 5.351465 ACAACAACAACAACAACAACAACAA 59.649 32.000 0.00 0.00 0.00 2.83
1513 2088 5.396750 ACAACAACAACAACAACAACAAC 57.603 34.783 0.00 0.00 0.00 3.32
1514 2089 4.870426 ACAACAACAACAACAACAACAACA 59.130 33.333 0.00 0.00 0.00 3.33
1515 2090 5.351465 ACAACAACAACAACAACAACAACAA 59.649 32.000 0.00 0.00 0.00 2.83
1516 2091 5.396750 ACAACAACAACAACAACAACAAC 57.603 34.783 0.00 0.00 0.00 3.32
1517 2092 4.870426 ACAACAACAACAACAACAACAACA 59.130 33.333 0.00 0.00 0.00 3.33
1518 2093 5.351465 ACAACAACAACAACAACAACAACAA 59.649 32.000 0.00 0.00 0.00 2.83
1519 2094 5.396750 ACAACAACAACAACAACAACAAC 57.603 34.783 0.00 0.00 0.00 3.32
1552 2127 5.649602 ACAACAACAACAACAACAACAAG 57.350 34.783 0.00 0.00 0.00 3.16
1784 2646 5.233225 TCTGCATCAACAACAAAAACAACA 58.767 33.333 0.00 0.00 0.00 3.33
1785 2647 5.698089 TCTGCATCAACAACAAAAACAACAA 59.302 32.000 0.00 0.00 0.00 2.83
1786 2648 5.683859 TGCATCAACAACAAAAACAACAAC 58.316 33.333 0.00 0.00 0.00 3.32
1997 2883 1.202806 CCCTCCATATTGCACCATCGT 60.203 52.381 0.00 0.00 0.00 3.73
2275 3240 9.476202 AGTATTTTCTTGGACTTTAATTTGCAC 57.524 29.630 0.00 0.00 0.00 4.57
2276 3241 9.255304 GTATTTTCTTGGACTTTAATTTGCACA 57.745 29.630 0.00 0.00 0.00 4.57
2647 3612 4.700365 GCTTGCCGGCGTGGAAAC 62.700 66.667 23.90 1.38 42.00 2.78
2790 3761 0.400594 AAGCTTGCCGGGTAGAAACT 59.599 50.000 2.18 0.00 0.00 2.66
3068 4042 1.544691 GACACATGTCTGACGGGTAGT 59.455 52.381 4.72 5.24 41.65 2.73
3070 4044 1.272490 CACATGTCTGACGGGTAGTGT 59.728 52.381 0.00 0.00 0.00 3.55
3116 4090 2.223923 CCGATCTGACCCTCAAGATGAC 60.224 54.545 0.00 0.00 0.00 3.06
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
51 52 6.147164 ACGTCACGTTTCTCATACATTCAATT 59.853 34.615 0.00 0.00 36.35 2.32
53 54 4.986034 ACGTCACGTTTCTCATACATTCAA 59.014 37.500 0.00 0.00 36.35 2.69
494 532 3.485947 TGACTTGCACACAAACAAGAC 57.514 42.857 9.54 4.30 44.89 3.01
542 580 5.221891 AGCAAGCATAAACATGTTCTACG 57.778 39.130 12.39 2.38 0.00 3.51
592 636 7.658167 TGACTCGTGAAATTCCTTTTACATGTA 59.342 33.333 0.08 0.08 32.03 2.29
610 654 3.448686 CTTTAGTAGGCCATGACTCGTG 58.551 50.000 5.01 0.00 0.00 4.35
653 698 8.467598 GTCTTGTGTGGTCTGTTAAGATAGATA 58.532 37.037 0.00 0.00 34.13 1.98
654 699 7.179338 AGTCTTGTGTGGTCTGTTAAGATAGAT 59.821 37.037 0.00 0.00 34.13 1.98
695 742 4.970860 ACTAGATAAGCATGGCTGTCAT 57.029 40.909 0.00 0.00 39.62 3.06
765 812 4.016444 TCAAACACTAATCTGGATTGCCC 58.984 43.478 6.13 0.00 32.50 5.36
879 926 6.402226 GGCACTACTTACAAGTGTATTCTTGC 60.402 42.308 4.86 3.37 45.86 4.01
1060 1107 1.818060 TGCTTGGCTTAAATGATGCGT 59.182 42.857 0.00 0.00 0.00 5.24
1433 1623 4.736168 GCTGCTGTGAAATTGGTTGTTGTA 60.736 41.667 0.00 0.00 0.00 2.41
1505 2080 5.351465 TGTTGTTGTTGTTGTTGTTGTTGTT 59.649 32.000 0.00 0.00 0.00 2.83
1506 2081 4.870426 TGTTGTTGTTGTTGTTGTTGTTGT 59.130 33.333 0.00 0.00 0.00 3.32
1507 2082 5.395325 TGTTGTTGTTGTTGTTGTTGTTG 57.605 34.783 0.00 0.00 0.00 3.33
1508 2083 5.351465 TGTTGTTGTTGTTGTTGTTGTTGTT 59.649 32.000 0.00 0.00 0.00 2.83
1509 2084 4.870426 TGTTGTTGTTGTTGTTGTTGTTGT 59.130 33.333 0.00 0.00 0.00 3.32
1510 2085 5.395325 TGTTGTTGTTGTTGTTGTTGTTG 57.605 34.783 0.00 0.00 0.00 3.33
1511 2086 5.351465 TGTTGTTGTTGTTGTTGTTGTTGTT 59.649 32.000 0.00 0.00 0.00 2.83
1512 2087 4.870426 TGTTGTTGTTGTTGTTGTTGTTGT 59.130 33.333 0.00 0.00 0.00 3.32
1513 2088 5.395325 TGTTGTTGTTGTTGTTGTTGTTG 57.605 34.783 0.00 0.00 0.00 3.33
1514 2089 5.351465 TGTTGTTGTTGTTGTTGTTGTTGTT 59.649 32.000 0.00 0.00 0.00 2.83
1515 2090 4.870426 TGTTGTTGTTGTTGTTGTTGTTGT 59.130 33.333 0.00 0.00 0.00 3.32
1516 2091 5.395325 TGTTGTTGTTGTTGTTGTTGTTG 57.605 34.783 0.00 0.00 0.00 3.33
1517 2092 5.351465 TGTTGTTGTTGTTGTTGTTGTTGTT 59.649 32.000 0.00 0.00 0.00 2.83
1518 2093 4.870426 TGTTGTTGTTGTTGTTGTTGTTGT 59.130 33.333 0.00 0.00 0.00 3.32
1519 2094 5.395325 TGTTGTTGTTGTTGTTGTTGTTG 57.605 34.783 0.00 0.00 0.00 3.33
1552 2127 9.276397 CAAAATTTGTTGAAGGATTTGTTGTTC 57.724 29.630 0.00 0.00 0.00 3.18
1614 2461 0.238289 GCGCTATGTTGTGTTGCTGT 59.762 50.000 0.00 0.00 0.00 4.40
1784 2646 1.336755 GGCTCGATGGTTGTTGTTGTT 59.663 47.619 0.00 0.00 0.00 2.83
1785 2647 0.951558 GGCTCGATGGTTGTTGTTGT 59.048 50.000 0.00 0.00 0.00 3.32
1786 2648 0.950836 TGGCTCGATGGTTGTTGTTG 59.049 50.000 0.00 0.00 0.00 3.33
2294 3259 5.659525 TGTTAAGATTTACCAGATCGAGGGA 59.340 40.000 11.27 0.35 0.00 4.20
2427 3392 2.990740 AAAGAGGCCCACCATTTACA 57.009 45.000 0.00 0.00 39.06 2.41
2647 3612 0.962356 ATCTTTCTGTGCCGGCAAGG 60.962 55.000 34.66 25.87 44.97 3.61
2790 3761 1.040339 AAGCTTTCCACACCGGCAAA 61.040 50.000 0.00 0.00 33.14 3.68
2843 3814 5.821516 ACTTCTCGTTCGATTGACTATCT 57.178 39.130 0.00 0.00 0.00 1.98
3068 4042 3.411446 CAACACAGGCTATTTCCTCACA 58.589 45.455 0.00 0.00 33.25 3.58
3070 4044 2.436417 GCAACACAGGCTATTTCCTCA 58.564 47.619 0.00 0.00 33.25 3.86


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.