Multiple sequence alignment - TraesCS6A01G044300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G044300 chr6A 100.000 2846 0 0 1 2846 23024110 23026955 0.000000e+00 5256.0
1 TraesCS6A01G044300 chr6A 88.225 2225 218 16 2 2193 23443023 23440810 0.000000e+00 2617.0
2 TraesCS6A01G044300 chr6A 85.708 2134 260 25 2 2106 22817088 22819205 0.000000e+00 2209.0
3 TraesCS6A01G044300 chr6A 86.789 1196 112 14 1024 2193 22988236 22989411 0.000000e+00 1291.0
4 TraesCS6A01G044300 chr6A 87.615 218 17 6 2630 2845 22990081 22990290 7.880000e-61 244.0
5 TraesCS6A01G044300 chr6A 76.350 389 44 28 2241 2618 22824593 22824944 6.310000e-37 165.0
6 TraesCS6A01G044300 chr6A 89.873 79 6 2 2768 2845 22996348 22996425 1.800000e-17 100.0
7 TraesCS6A01G044300 chr6A 89.873 79 6 2 2768 2845 22996661 22996738 1.800000e-17 100.0
8 TraesCS6A01G044300 chrUn 100.000 2559 0 0 288 2846 284476487 284473929 0.000000e+00 4726.0
9 TraesCS6A01G044300 chrUn 86.256 2874 329 33 2 2842 278293374 278296214 0.000000e+00 3059.0
10 TraesCS6A01G044300 chr6D 91.281 2225 151 15 2 2193 24364332 24362118 0.000000e+00 2994.0
11 TraesCS6A01G044300 chr6D 90.930 2227 156 16 2 2193 24430104 24432319 0.000000e+00 2952.0
12 TraesCS6A01G044300 chr6D 87.838 2220 211 21 2 2193 24403191 24405379 0.000000e+00 2549.0
13 TraesCS6A01G044300 chr6D 87.005 2224 211 32 2 2193 24357096 24354919 0.000000e+00 2435.0
14 TraesCS6A01G044300 chr6D 86.932 2158 211 29 2 2124 24334662 24332541 0.000000e+00 2357.0
15 TraesCS6A01G044300 chr6D 91.851 1718 97 13 509 2193 24339996 24338289 0.000000e+00 2357.0
16 TraesCS6A01G044300 chr6D 86.074 2226 264 17 2 2193 24353355 24351142 0.000000e+00 2351.0
17 TraesCS6A01G044300 chr6D 85.374 2181 269 24 2 2155 24347784 24345627 0.000000e+00 2215.0
18 TraesCS6A01G044300 chr6D 85.374 2181 269 24 2 2155 24391543 24393700 0.000000e+00 2215.0
19 TraesCS6A01G044300 chr6D 87.241 290 27 3 2209 2490 24350699 24350412 3.540000e-84 322.0
20 TraesCS6A01G044300 chr6D 84.175 297 27 9 2563 2846 24406615 24406904 1.300000e-68 270.0
21 TraesCS6A01G044300 chr6D 84.192 291 26 9 2569 2846 24322045 24321762 6.050000e-67 265.0
22 TraesCS6A01G044300 chr6D 86.364 242 25 7 2569 2807 24361551 24361315 1.010000e-64 257.0
23 TraesCS6A01G044300 chr6D 82.927 287 25 10 2569 2842 24353736 24353461 1.320000e-58 237.0
24 TraesCS6A01G044300 chr6D 86.577 149 10 1 2528 2676 24350412 24350274 3.800000e-34 156.0
25 TraesCS6A01G044300 chr6D 87.705 122 8 3 2660 2780 24438363 24438478 4.950000e-28 135.0
26 TraesCS6A01G044300 chr6D 86.842 114 12 3 2208 2321 24337841 24337731 1.070000e-24 124.0
27 TraesCS6A01G044300 chr6D 86.842 114 12 3 2208 2321 24432767 24432877 1.070000e-24 124.0
28 TraesCS6A01G044300 chr6D 83.784 74 10 1 2293 2364 24337713 24337640 5.090000e-08 69.4
29 TraesCS6A01G044300 chr6D 83.784 74 10 1 2293 2364 24432895 24432968 5.090000e-08 69.4
30 TraesCS6A01G044300 chr6B 87.822 2020 187 17 2 1998 39755779 39757762 0.000000e+00 2313.0
31 TraesCS6A01G044300 chr6B 92.955 1235 76 5 2 1233 39434011 39435237 0.000000e+00 1788.0
32 TraesCS6A01G044300 chr6B 90.404 990 56 11 1230 2193 39455652 39456628 0.000000e+00 1266.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G044300 chr6A 23024110 23026955 2845 False 5256.000000 5256 100.000000 1 2846 1 chr6A.!!$F3 2845
1 TraesCS6A01G044300 chr6A 23440810 23443023 2213 True 2617.000000 2617 88.225000 2 2193 1 chr6A.!!$R1 2191
2 TraesCS6A01G044300 chr6A 22817088 22819205 2117 False 2209.000000 2209 85.708000 2 2106 1 chr6A.!!$F1 2104
3 TraesCS6A01G044300 chr6A 22988236 22990290 2054 False 767.500000 1291 87.202000 1024 2845 2 chr6A.!!$F4 1821
4 TraesCS6A01G044300 chrUn 284473929 284476487 2558 True 4726.000000 4726 100.000000 288 2846 1 chrUn.!!$R1 2558
5 TraesCS6A01G044300 chrUn 278293374 278296214 2840 False 3059.000000 3059 86.256000 2 2842 1 chrUn.!!$F1 2840
6 TraesCS6A01G044300 chr6D 24391543 24393700 2157 False 2215.000000 2215 85.374000 2 2155 1 chr6D.!!$F1 2153
7 TraesCS6A01G044300 chr6D 24361315 24364332 3017 True 1625.500000 2994 88.822500 2 2807 2 chr6D.!!$R4 2805
8 TraesCS6A01G044300 chr6D 24403191 24406904 3713 False 1409.500000 2549 86.006500 2 2846 2 chr6D.!!$F3 2844
9 TraesCS6A01G044300 chr6D 24345627 24357096 11469 True 1286.000000 2435 85.866333 2 2842 6 chr6D.!!$R3 2840
10 TraesCS6A01G044300 chr6D 24332541 24339996 7455 True 1226.850000 2357 87.352250 2 2364 4 chr6D.!!$R2 2362
11 TraesCS6A01G044300 chr6D 24430104 24432968 2864 False 1048.466667 2952 87.185333 2 2364 3 chr6D.!!$F4 2362
12 TraesCS6A01G044300 chr6B 39755779 39757762 1983 False 2313.000000 2313 87.822000 2 1998 1 chr6B.!!$F3 1996
13 TraesCS6A01G044300 chr6B 39434011 39435237 1226 False 1788.000000 1788 92.955000 2 1233 1 chr6B.!!$F1 1231
14 TraesCS6A01G044300 chr6B 39455652 39456628 976 False 1266.000000 1266 90.404000 1230 2193 1 chr6B.!!$F2 963

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
195 197 3.243975 GGACCTTCGTTCTAACAACCTGA 60.244 47.826 0.0 0.0 0.0 3.86 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1851 11488 5.453158 ACCAGTGATAGTCATCTCATCTCA 58.547 41.667 0.0 0.0 31.93 3.27 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
180 181 7.336931 TCAAACAGCTAATAATTCTGGACCTTC 59.663 37.037 0.00 0.0 32.42 3.46
195 197 3.243975 GGACCTTCGTTCTAACAACCTGA 60.244 47.826 0.00 0.0 0.00 3.86
235 237 6.636562 AGGTCATTTATCACGTCTAGGTAG 57.363 41.667 0.00 0.0 0.00 3.18
1851 11488 8.055790 AGAGCTAAAATTAATGGGTAGAAGCTT 58.944 33.333 0.00 0.0 36.76 3.74
2716 13615 4.516698 GTGGGATCCAATATTGTGCTACTG 59.483 45.833 15.23 0.0 34.18 2.74
2717 13616 3.503748 GGGATCCAATATTGTGCTACTGC 59.496 47.826 15.23 0.0 40.20 4.40
2718 13617 4.392940 GGATCCAATATTGTGCTACTGCT 58.607 43.478 14.25 0.0 40.48 4.24
2719 13618 5.513094 GGGATCCAATATTGTGCTACTGCTA 60.513 44.000 15.23 0.0 40.48 3.49
2720 13619 5.409826 GGATCCAATATTGTGCTACTGCTAC 59.590 44.000 14.25 0.0 40.48 3.58
2721 13620 4.368315 TCCAATATTGTGCTACTGCTACG 58.632 43.478 14.25 0.0 40.48 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 5.413523 ACCATTGTAGTTTATTCCGTGAACC 59.586 40.000 0.0 0.0 0.00 3.62
180 181 2.747446 CCCCATTCAGGTTGTTAGAACG 59.253 50.000 0.0 0.0 34.66 3.95
195 197 3.527253 TGACCTTCATGTATGACCCCATT 59.473 43.478 0.0 0.0 36.36 3.16
235 237 6.484977 GTCTGATAATCTCAATTCCTCCAACC 59.515 42.308 0.0 0.0 32.14 3.77
1851 11488 5.453158 ACCAGTGATAGTCATCTCATCTCA 58.547 41.667 0.0 0.0 31.93 3.27
2716 13615 2.395654 GCACAGTAAGATAGCCGTAGC 58.604 52.381 0.0 0.0 40.32 3.58
2717 13616 2.033049 ACGCACAGTAAGATAGCCGTAG 59.967 50.000 0.0 0.0 0.00 3.51
2718 13617 2.019249 ACGCACAGTAAGATAGCCGTA 58.981 47.619 0.0 0.0 0.00 4.02
2719 13618 0.815734 ACGCACAGTAAGATAGCCGT 59.184 50.000 0.0 0.0 0.00 5.68
2720 13619 1.200483 CACGCACAGTAAGATAGCCG 58.800 55.000 0.0 0.0 0.00 5.52
2721 13620 2.194271 GACACGCACAGTAAGATAGCC 58.806 52.381 0.0 0.0 0.00 3.93


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.