Multiple sequence alignment - TraesCS6A01G029000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G029000 chr6A 100.000 2561 0 0 1 2561 15386866 15384306 0.000000e+00 4730
1 TraesCS6A01G029000 chr6A 75.321 1325 277 36 990 2298 137493927 137492637 7.890000e-165 590
2 TraesCS6A01G029000 chr7A 98.129 2566 34 11 1 2561 610463548 610460992 0.000000e+00 4460
3 TraesCS6A01G029000 chr7A 75.684 1316 290 24 990 2298 126148074 126149366 4.650000e-177 630
4 TraesCS6A01G029000 chr4A 97.468 2567 56 6 1 2561 180271616 180269053 0.000000e+00 4372
5 TraesCS6A01G029000 chr4A 94.687 1694 84 3 868 2561 729544596 729542909 0.000000e+00 2625
6 TraesCS6A01G029000 chr4A 95.397 717 31 2 1 716 729545307 729544592 0.000000e+00 1140
7 TraesCS6A01G029000 chr3B 96.409 1476 46 4 1088 2561 607809354 607807884 0.000000e+00 2425
8 TraesCS6A01G029000 chr3B 95.890 1095 34 7 1 1089 607810537 607809448 0.000000e+00 1762
9 TraesCS6A01G029000 chr3B 76.194 1319 278 27 990 2298 473235215 473236507 0.000000e+00 664
10 TraesCS6A01G029000 chr3B 88.418 354 33 4 1 347 534161154 534161506 1.100000e-113 420
11 TraesCS6A01G029000 chr7D 97.980 1287 25 1 1275 2561 194638625 194639910 0.000000e+00 2231
12 TraesCS6A01G029000 chr7D 96.637 1219 31 7 1 1216 194637417 194638628 0.000000e+00 2015
13 TraesCS6A01G029000 chr3A 97.352 642 16 1 1 641 584382222 584382863 0.000000e+00 1090
14 TraesCS6A01G029000 chr5A 97.440 625 16 0 1 625 567267144 567267768 0.000000e+00 1066
15 TraesCS6A01G029000 chr4B 75.114 1318 292 25 990 2298 321541563 321542853 3.670000e-163 584


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G029000 chr6A 15384306 15386866 2560 True 4730.0 4730 100.0000 1 2561 1 chr6A.!!$R1 2560
1 TraesCS6A01G029000 chr6A 137492637 137493927 1290 True 590.0 590 75.3210 990 2298 1 chr6A.!!$R2 1308
2 TraesCS6A01G029000 chr7A 610460992 610463548 2556 True 4460.0 4460 98.1290 1 2561 1 chr7A.!!$R1 2560
3 TraesCS6A01G029000 chr7A 126148074 126149366 1292 False 630.0 630 75.6840 990 2298 1 chr7A.!!$F1 1308
4 TraesCS6A01G029000 chr4A 180269053 180271616 2563 True 4372.0 4372 97.4680 1 2561 1 chr4A.!!$R1 2560
5 TraesCS6A01G029000 chr4A 729542909 729545307 2398 True 1882.5 2625 95.0420 1 2561 2 chr4A.!!$R2 2560
6 TraesCS6A01G029000 chr3B 607807884 607810537 2653 True 2093.5 2425 96.1495 1 2561 2 chr3B.!!$R1 2560
7 TraesCS6A01G029000 chr3B 473235215 473236507 1292 False 664.0 664 76.1940 990 2298 1 chr3B.!!$F1 1308
8 TraesCS6A01G029000 chr7D 194637417 194639910 2493 False 2123.0 2231 97.3085 1 2561 2 chr7D.!!$F1 2560
9 TraesCS6A01G029000 chr3A 584382222 584382863 641 False 1090.0 1090 97.3520 1 641 1 chr3A.!!$F1 640
10 TraesCS6A01G029000 chr5A 567267144 567267768 624 False 1066.0 1066 97.4400 1 625 1 chr5A.!!$F1 624
11 TraesCS6A01G029000 chr4B 321541563 321542853 1290 False 584.0 584 75.1140 990 2298 1 chr4B.!!$F1 1308

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
666 668 2.590821 ACATGCTTGGAGCTGTCTTTT 58.409 42.857 4.44 0.0 42.97 2.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1706 1815 6.526325 CACATACACCCAAAACATTTGTATCG 59.474 38.462 2.53 0.0 32.3 2.92 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
26 27 3.391049 CCGGATCTATCGTTTCCTTTCC 58.609 50.000 0.00 0.0 0.00 3.13
107 108 2.632996 AGTCGACCAGTTGAGATTTGGA 59.367 45.455 13.01 0.0 35.89 3.53
421 422 5.945784 TGCATTACCTAGATTTTCTTGTGCT 59.054 36.000 0.00 0.0 0.00 4.40
651 653 4.808364 TGTTAGGTTGCAAAAGAAACATGC 59.192 37.500 0.00 0.0 40.45 4.06
666 668 2.590821 ACATGCTTGGAGCTGTCTTTT 58.409 42.857 4.44 0.0 42.97 2.27
747 749 5.648960 TGGTACTCGTTTGGTTTCTTTCTTT 59.351 36.000 0.00 0.0 0.00 2.52
759 761 8.477419 TGGTTTCTTTCTTTATTGATTGGAGT 57.523 30.769 0.00 0.0 0.00 3.85
1706 1815 1.419387 AGGTCAAGGCTGGCTGATATC 59.581 52.381 3.84 0.0 0.00 1.63
1997 2106 2.189342 CTGCACGCTAGAGCTAGAAAC 58.811 52.381 8.65 0.0 39.32 2.78
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
107 108 1.942657 GCGCACATCCATGAACAGTAT 59.057 47.619 0.30 0.0 0.0 2.12
421 422 2.370349 TCACCCTCGCAAAACAAAAGA 58.630 42.857 0.00 0.0 0.0 2.52
510 512 6.892658 TTCTTTAAATAACAAGCAGCCTCA 57.107 33.333 0.00 0.0 0.0 3.86
651 653 5.505173 TGAAAAGAAAAGACAGCTCCAAG 57.495 39.130 0.00 0.0 0.0 3.61
666 668 7.334090 AGTGCAAAGCTATAGAGATGAAAAGA 58.666 34.615 3.21 0.0 0.0 2.52
747 749 1.887797 ACCCCCGACTCCAATCAATA 58.112 50.000 0.00 0.0 0.0 1.90
805 815 5.614324 AGCAAGCAACCTATATGAGTACA 57.386 39.130 0.00 0.0 0.0 2.90
1706 1815 6.526325 CACATACACCCAAAACATTTGTATCG 59.474 38.462 2.53 0.0 32.3 2.92
1997 2106 7.282675 AGTCTTCCAAAGCATCTCTCAATAATG 59.717 37.037 0.00 0.0 0.0 1.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.