Multiple sequence alignment - TraesCS6A01G021600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G021600 chr6A 100.000 2888 0 0 1 2888 10559032 10561919 0.000000e+00 5334.0
1 TraesCS6A01G021600 chr6A 98.615 2889 37 3 1 2888 10516470 10519356 0.000000e+00 5110.0
2 TraesCS6A01G021600 chr6A 93.657 2901 158 8 1 2887 10917615 10920503 0.000000e+00 4314.0
3 TraesCS6A01G021600 chr6A 95.926 2283 92 1 1 2283 10600167 10602448 0.000000e+00 3699.0
4 TraesCS6A01G021600 chr6A 95.861 604 23 2 2282 2885 10609521 10610122 0.000000e+00 976.0
5 TraesCS6A01G021600 chr6A 93.730 319 17 3 2506 2822 588602430 588602113 2.600000e-130 475.0
6 TraesCS6A01G021600 chr6A 93.438 320 18 3 2506 2823 235919605 235919287 3.370000e-129 472.0
7 TraesCS6A01G021600 chr6D 95.829 2901 101 5 1 2886 9586912 9589807 0.000000e+00 4669.0
8 TraesCS6A01G021600 chr6D 95.673 2889 119 5 1 2887 9792514 9795398 0.000000e+00 4638.0
9 TraesCS6A01G021600 chr6D 91.964 336 23 4 2506 2838 179949781 179949447 4.360000e-128 468.0
10 TraesCS6A01G021600 chr6B 92.526 2154 134 9 146 2278 17532958 17535105 0.000000e+00 3061.0
11 TraesCS6A01G021600 chr6B 90.691 2170 164 19 131 2278 17704939 17702786 0.000000e+00 2854.0
12 TraesCS6A01G021600 chr6B 92.805 1501 86 2 738 2217 17685747 17687246 0.000000e+00 2154.0
13 TraesCS6A01G021600 chr6B 92.574 202 12 2 2310 2508 17687246 17687447 1.310000e-73 287.0
14 TraesCS6A01G021600 chr6B 78.706 371 73 5 1165 1532 17686372 17686739 2.880000e-60 243.0
15 TraesCS6A01G021600 chr6B 95.935 123 5 0 1 123 17532842 17532964 1.750000e-47 200.0
16 TraesCS6A01G021600 chr6B 80.738 244 45 2 1551 1793 17703908 17703666 3.800000e-44 189.0
17 TraesCS6A01G021600 chr6B 100.000 29 0 0 2294 2322 17535039 17535067 1.000000e-03 54.7
18 TraesCS6A01G021600 chr6B 100.000 29 0 0 2294 2322 17702852 17702824 1.000000e-03 54.7
19 TraesCS6A01G021600 chr3A 92.923 325 18 5 2499 2822 395477612 395477932 4.360000e-128 468.0
20 TraesCS6A01G021600 chr3D 89.474 57 6 0 667 723 419872919 419872863 3.990000e-09 73.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G021600 chr6A 10559032 10561919 2887 False 5334.000000 5334 100.000000 1 2888 1 chr6A.!!$F2 2887
1 TraesCS6A01G021600 chr6A 10516470 10519356 2886 False 5110.000000 5110 98.615000 1 2888 1 chr6A.!!$F1 2887
2 TraesCS6A01G021600 chr6A 10917615 10920503 2888 False 4314.000000 4314 93.657000 1 2887 1 chr6A.!!$F5 2886
3 TraesCS6A01G021600 chr6A 10600167 10602448 2281 False 3699.000000 3699 95.926000 1 2283 1 chr6A.!!$F3 2282
4 TraesCS6A01G021600 chr6A 10609521 10610122 601 False 976.000000 976 95.861000 2282 2885 1 chr6A.!!$F4 603
5 TraesCS6A01G021600 chr6D 9586912 9589807 2895 False 4669.000000 4669 95.829000 1 2886 1 chr6D.!!$F1 2885
6 TraesCS6A01G021600 chr6D 9792514 9795398 2884 False 4638.000000 4638 95.673000 1 2887 1 chr6D.!!$F2 2886
7 TraesCS6A01G021600 chr6B 17532842 17535105 2263 False 1105.233333 3061 96.153667 1 2322 3 chr6B.!!$F1 2321
8 TraesCS6A01G021600 chr6B 17702786 17704939 2153 True 1032.566667 2854 90.476333 131 2322 3 chr6B.!!$R1 2191
9 TraesCS6A01G021600 chr6B 17685747 17687447 1700 False 894.666667 2154 88.028333 738 2508 3 chr6B.!!$F2 1770

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
265 267 1.663379 CCTGCGGTGTAGGATCGTCA 61.663 60.000 0.0 0.0 37.63 4.35 F
1455 1460 1.532868 GACGCAGCAAAGTCTGTTGAT 59.467 47.619 0.0 0.0 38.47 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1816 1857 1.098050 GCATCAGCCTCGGATTTTGT 58.902 50.000 0.0 0.0 33.58 2.83 R
2537 2596 8.798975 TTCCTATGACTTTCCTATTCCTATGT 57.201 34.615 0.0 0.0 0.00 2.29 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
265 267 1.663379 CCTGCGGTGTAGGATCGTCA 61.663 60.000 0.00 0.00 37.63 4.35
458 460 2.347697 CGACTTCTCATGGTCGTTGA 57.652 50.000 12.37 0.00 46.63 3.18
834 839 4.718276 GGGTTACCACATACCTTTCTAGGA 59.282 45.833 2.98 0.00 39.34 2.94
900 905 5.133999 ACATTCATGGGAGAGATTTCCTGAT 59.866 40.000 0.00 0.00 37.40 2.90
922 927 9.814899 CTGATCTCACATTGTCTCTATAAAAGT 57.185 33.333 0.00 0.00 0.00 2.66
1399 1404 1.533625 CATCAAGAAGGCCGAAACCA 58.466 50.000 0.00 0.00 0.00 3.67
1455 1460 1.532868 GACGCAGCAAAGTCTGTTGAT 59.467 47.619 0.00 0.00 38.47 2.57
1523 1528 4.706616 AGTTCTTCTACCTCCCCCAATAA 58.293 43.478 0.00 0.00 0.00 1.40
1816 1857 1.131638 ATCCGCTAAGAAGGATGCCA 58.868 50.000 0.00 0.00 44.88 4.92
1818 1859 0.107703 CCGCTAAGAAGGATGCCACA 60.108 55.000 0.00 0.00 0.00 4.17
1993 2034 3.018149 TGCTAATTCTCATGCATGCACA 58.982 40.909 25.37 11.98 0.00 4.57
2079 2120 5.997746 AGTAAGACATGCTTGACTTGCTTTA 59.002 36.000 21.82 5.31 43.72 1.85
2222 2267 4.488126 AATTGGACGACTCAATGTGTTG 57.512 40.909 1.47 1.47 35.31 3.33
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
265 267 0.315886 TGACATTCGGTGTGCGTACT 59.684 50.000 4.97 0.00 42.36 2.73
458 460 2.430465 GTGAGCAAGGTGTGACATGAT 58.570 47.619 0.00 0.00 0.00 2.45
550 552 0.884704 GGACACCATGCACGACTGTT 60.885 55.000 0.00 0.00 0.00 3.16
834 839 4.581309 ATGAATGTGAGGTCACCAGAAT 57.419 40.909 7.64 0.00 45.88 2.40
922 927 5.828328 ACACATGATTCGTAGAGGTGATAGA 59.172 40.000 0.00 0.00 38.43 1.98
1153 1158 1.768112 GCGGCAACAACACGTGTAGT 61.768 55.000 23.69 3.90 40.60 2.73
1202 1207 1.754745 GCCTCTTCTGGTGTGGTGA 59.245 57.895 0.00 0.00 0.00 4.02
1399 1404 3.116091 CCTTTGCAGGTGTCTTGGT 57.884 52.632 0.00 0.00 35.06 3.67
1455 1460 4.276642 TGGCACCATACTTTAATGCATCA 58.723 39.130 0.00 0.00 38.05 3.07
1523 1528 2.787994 CATCAGTGGTGCCTTCTTTCT 58.212 47.619 0.00 0.00 0.00 2.52
1816 1857 1.098050 GCATCAGCCTCGGATTTTGT 58.902 50.000 0.00 0.00 33.58 2.83
1818 1859 1.838112 TTGCATCAGCCTCGGATTTT 58.162 45.000 0.00 0.00 41.13 1.82
1993 2034 6.038050 TCGTAATGGGAACGTTTAAACAAAGT 59.962 34.615 18.07 5.45 40.80 2.66
2117 2162 7.415206 GCGGTGGAACTCATATTACTGATTTTT 60.415 37.037 0.00 0.00 36.74 1.94
2123 2168 3.792401 TGCGGTGGAACTCATATTACTG 58.208 45.455 0.00 0.00 36.74 2.74
2125 2170 5.751243 AATTGCGGTGGAACTCATATTAC 57.249 39.130 0.00 0.00 36.74 1.89
2537 2596 8.798975 TTCCTATGACTTTCCTATTCCTATGT 57.201 34.615 0.00 0.00 0.00 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.