Multiple sequence alignment - TraesCS6A01G021500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS6A01G021500 chr6A 100.000 2777 0 0 1 2777 10516582 10519358 0.000000e+00 5129.0
1 TraesCS6A01G021500 chr6A 98.596 2778 36 3 1 2776 10559144 10561920 0.000000e+00 4911.0
2 TraesCS6A01G021500 chr6A 93.797 2789 146 9 1 2774 10917727 10920503 0.000000e+00 4167.0
3 TraesCS6A01G021500 chr6A 96.225 2172 80 2 1 2172 10600279 10602448 0.000000e+00 3555.0
4 TraesCS6A01G021500 chr6A 95.854 603 23 2 2171 2772 10609521 10610122 0.000000e+00 974.0
5 TraesCS6A01G021500 chr6A 94.340 318 16 2 2394 2709 588602430 588602113 1.160000e-133 486.0
6 TraesCS6A01G021500 chr6D 96.090 2788 90 5 1 2773 9587024 9589807 0.000000e+00 4527.0
7 TraesCS6A01G021500 chr6D 95.931 2777 106 6 1 2774 9792626 9795398 0.000000e+00 4495.0
8 TraesCS6A01G021500 chr6D 91.940 335 24 3 2394 2725 179949781 179949447 1.510000e-127 466.0
9 TraesCS6A01G021500 chr6B 92.797 2152 127 10 37 2167 17532961 17535105 0.000000e+00 3090.0
10 TraesCS6A01G021500 chr6B 90.926 2171 158 20 19 2167 17704939 17702786 0.000000e+00 2881.0
11 TraesCS6A01G021500 chr6B 93.205 1501 80 2 627 2106 17685747 17687246 0.000000e+00 2187.0
12 TraesCS6A01G021500 chr6B 91.584 202 13 3 2199 2396 17687246 17687447 2.720000e-70 276.0
13 TraesCS6A01G021500 chr6B 87.607 234 18 6 1906 2133 17535067 17535295 7.630000e-66 261.0
14 TraesCS6A01G021500 chr6B 78.043 419 79 9 1010 1421 17686327 17686739 4.590000e-63 252.0
15 TraesCS6A01G021500 chr6B 80.328 244 46 2 1440 1682 17703908 17703666 1.700000e-42 183.0
16 TraesCS6A01G021500 chr6B 100.000 29 0 0 2183 2211 17535039 17535067 1.000000e-03 54.7
17 TraesCS6A01G021500 chr6B 100.000 29 0 0 2183 2211 17702852 17702824 1.000000e-03 54.7
18 TraesCS6A01G021500 chr7D 95.425 306 13 1 2395 2699 539381773 539382078 1.160000e-133 486.0
19 TraesCS6A01G021500 chr3A 93.519 324 17 4 2387 2709 395477612 395477932 1.930000e-131 479.0
20 TraesCS6A01G021500 chr3D 89.474 57 6 0 556 612 419872919 419872863 3.840000e-09 73.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS6A01G021500 chr6A 10516582 10519358 2776 False 5129.000000 5129 100.000000 1 2777 1 chr6A.!!$F1 2776
1 TraesCS6A01G021500 chr6A 10559144 10561920 2776 False 4911.000000 4911 98.596000 1 2776 1 chr6A.!!$F2 2775
2 TraesCS6A01G021500 chr6A 10917727 10920503 2776 False 4167.000000 4167 93.797000 1 2774 1 chr6A.!!$F5 2773
3 TraesCS6A01G021500 chr6A 10600279 10602448 2169 False 3555.000000 3555 96.225000 1 2172 1 chr6A.!!$F3 2171
4 TraesCS6A01G021500 chr6A 10609521 10610122 601 False 974.000000 974 95.854000 2171 2772 1 chr6A.!!$F4 601
5 TraesCS6A01G021500 chr6D 9587024 9589807 2783 False 4527.000000 4527 96.090000 1 2773 1 chr6D.!!$F1 2772
6 TraesCS6A01G021500 chr6D 9792626 9795398 2772 False 4495.000000 4495 95.931000 1 2774 1 chr6D.!!$F2 2773
7 TraesCS6A01G021500 chr6B 17532961 17535295 2334 False 1135.233333 3090 93.468000 37 2211 3 chr6B.!!$F1 2174
8 TraesCS6A01G021500 chr6B 17702786 17704939 2153 True 1039.566667 2881 90.418000 19 2211 3 chr6B.!!$R1 2192
9 TraesCS6A01G021500 chr6B 17685747 17687447 1700 False 905.000000 2187 87.610667 627 2396 3 chr6B.!!$F2 1769

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
406 407 0.179059 ATGTCACGTCACTTGCCACA 60.179 50.0 0.0 0.0 0.0 4.17 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2260 2444 6.312141 TGGATGAAGGAAAGATGTATGACA 57.688 37.5 0.0 0.0 0.0 3.58 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
34 35 1.412710 TCCATGGCACCTAATCGTCTC 59.587 52.381 6.96 0.0 0.00 3.36
116 117 3.947834 CCGAGTCATGGCCTAAAGATTTT 59.052 43.478 3.32 0.0 0.00 1.82
406 407 0.179059 ATGTCACGTCACTTGCCACA 60.179 50.000 0.00 0.0 0.00 4.17
815 816 7.439655 CCTCACATTGTCTCTATAAAAGCCTAC 59.560 40.741 0.00 0.0 0.00 3.18
1008 1009 3.935203 AGAACACATTGAAGATGGCTACG 59.065 43.478 0.00 0.0 0.00 3.51
1181 1182 1.134189 CAATGCCATCTCTCAGCAGGA 60.134 52.381 0.00 0.0 40.40 3.86
1383 1384 0.813210 CCATCTCTCGGAAAGCAGCC 60.813 60.000 0.00 0.0 0.00 4.85
1684 1721 1.202806 CCACAAGACCTGAAGAGGCAA 60.203 52.381 0.00 0.0 44.33 4.52
2776 2979 5.614308 ACTGTCAAATTGAGTCATCTGTCA 58.386 37.500 0.00 0.0 0.00 3.58
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
34 35 3.126831 GAGCCACGACTTAGATGAATGG 58.873 50.000 0.00 0.0 0.00 3.16
116 117 0.837272 GCCCCAACTGGAGCTATACA 59.163 55.000 0.00 0.0 37.39 2.29
342 343 1.948834 CAAGGTGTGACATGAGCAACA 59.051 47.619 0.00 0.0 0.00 3.33
406 407 0.170116 CCGTGCGGTGCATTAATGTT 59.830 50.000 16.61 0.0 41.91 2.71
815 816 3.131223 AGACACATGATTCGTAGAGGTGG 59.869 47.826 0.00 0.0 38.43 4.61
1008 1009 3.529835 AACCCCTTTCCTGCTGGGC 62.530 63.158 10.07 0.0 42.07 5.36
1049 1050 1.577328 CTTCTCGGCGGCAACAACAT 61.577 55.000 10.53 0.0 0.00 2.71
2260 2444 6.312141 TGGATGAAGGAAAGATGTATGACA 57.688 37.500 0.00 0.0 0.00 3.58


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.