Multiple sequence alignment - TraesCS5D01G564200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G564200 chr5D 100.000 3393 0 0 1 3393 562925174 562928566 0 6266
1 TraesCS5D01G564200 chr1A 98.379 3394 49 2 1 3393 94765603 94762215 0 5958
2 TraesCS5D01G564200 chr2D 98.262 3394 58 1 1 3393 200934935 200938328 0 5939
3 TraesCS5D01G564200 chr2D 97.761 3394 73 3 1 3393 604416906 604420297 0 5843
4 TraesCS5D01G564200 chr7A 98.203 3394 60 1 1 3393 211308107 211311500 0 5928
5 TraesCS5D01G564200 chr7A 97.967 3394 68 1 1 3393 563544632 563548025 0 5884
6 TraesCS5D01G564200 chr1D 98.173 3394 59 2 1 3393 185786577 185783186 0 5921
7 TraesCS5D01G564200 chr6D 98.496 3324 49 1 71 3393 458889921 458893244 0 5860
8 TraesCS5D01G564200 chr7D 97.525 3394 83 1 1 3393 307118245 307114852 0 5801


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G564200 chr5D 562925174 562928566 3392 False 6266 6266 100.000 1 3393 1 chr5D.!!$F1 3392
1 TraesCS5D01G564200 chr1A 94762215 94765603 3388 True 5958 5958 98.379 1 3393 1 chr1A.!!$R1 3392
2 TraesCS5D01G564200 chr2D 200934935 200938328 3393 False 5939 5939 98.262 1 3393 1 chr2D.!!$F1 3392
3 TraesCS5D01G564200 chr2D 604416906 604420297 3391 False 5843 5843 97.761 1 3393 1 chr2D.!!$F2 3392
4 TraesCS5D01G564200 chr7A 211308107 211311500 3393 False 5928 5928 98.203 1 3393 1 chr7A.!!$F1 3392
5 TraesCS5D01G564200 chr7A 563544632 563548025 3393 False 5884 5884 97.967 1 3393 1 chr7A.!!$F2 3392
6 TraesCS5D01G564200 chr1D 185783186 185786577 3391 True 5921 5921 98.173 1 3393 1 chr1D.!!$R1 3392
7 TraesCS5D01G564200 chr6D 458889921 458893244 3323 False 5860 5860 98.496 71 3393 1 chr6D.!!$F1 3322
8 TraesCS5D01G564200 chr7D 307114852 307118245 3393 True 5801 5801 97.525 1 3393 1 chr7D.!!$R1 3392

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
540 541 3.065648 GGACAACCAAAAAGCGAGTAACA 59.934 43.478 0.0 0.0 35.97 2.41 F
1380 1382 5.464057 CGCAATATCGGTTGTAGTATTTCCA 59.536 40.000 0.0 0.0 0.00 3.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1432 1434 3.689161 TGCGACTTTGGTCCATGAATTAG 59.311 43.478 0.0 0.0 39.15 1.73 R
2974 2977 6.256757 GCAATTCGTCTTCACTAAGAGCTAAT 59.743 38.462 0.0 0.0 42.40 1.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
540 541 3.065648 GGACAACCAAAAAGCGAGTAACA 59.934 43.478 0.00 0.00 35.97 2.41
1146 1148 8.090831 GCTTTCACTTGGAAAATAGGAGATTTT 58.909 33.333 0.00 0.00 44.52 1.82
1380 1382 5.464057 CGCAATATCGGTTGTAGTATTTCCA 59.536 40.000 0.00 0.00 0.00 3.53
1432 1434 6.138761 GCATAATCGGTTGTTCATGATCTTC 58.861 40.000 0.00 0.00 0.00 2.87
1796 1799 2.009774 CAACCCTGAAGCGAACTATGG 58.990 52.381 0.00 0.00 0.00 2.74
2974 2977 7.382488 GCGTCATATTTGCTAGATTTCTAGTCA 59.618 37.037 14.43 10.56 45.85 3.41
3240 3243 5.126707 CGGGGAACTCTACACTATTGTACTT 59.873 44.000 0.00 0.00 37.15 2.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
227 228 3.865745 CAGAGCAAATAGGAAGGTACACG 59.134 47.826 0.00 0.00 0.00 4.49
362 363 4.262635 CCGGCCTACTCTTCATTGATACAT 60.263 45.833 0.00 0.00 0.00 2.29
540 541 1.982938 ACCCGCCGCTCTCTTACTT 60.983 57.895 0.00 0.00 0.00 2.24
680 681 7.436080 CACTCTACTTTTGGTAACGAACTTACA 59.564 37.037 0.00 0.00 40.58 2.41
1094 1095 0.725117 GACGAATAACCAACCCGCAG 59.275 55.000 0.00 0.00 0.00 5.18
1146 1148 1.686355 ACCAATCAAAGCGTGGAACA 58.314 45.000 0.00 0.00 35.74 3.18
1380 1382 9.640952 ACATCTCTCTTAGCTTATAGAAAGAGT 57.359 33.333 17.22 6.98 43.46 3.24
1432 1434 3.689161 TGCGACTTTGGTCCATGAATTAG 59.311 43.478 0.00 0.00 39.15 1.73
1796 1799 6.876257 TGGAAGAGACTGCTAGATTTCTTTTC 59.124 38.462 0.00 2.21 31.54 2.29
1870 1873 5.600069 ACATTCCTTCTTCTTTCCAAGCTTT 59.400 36.000 0.00 0.00 0.00 3.51
2974 2977 6.256757 GCAATTCGTCTTCACTAAGAGCTAAT 59.743 38.462 0.00 0.00 42.40 1.73
3240 3243 9.988815 GATACTTTCTTGAAGGAATAGCATCTA 57.011 33.333 0.00 0.00 39.79 1.98


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.