Multiple sequence alignment - TraesCS5D01G556100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G556100 chr5D 100.000 2849 0 0 1 2849 559473698 559470850 0 5262
1 TraesCS5D01G556100 chr5D 95.870 2857 80 14 1 2849 559356918 559359744 0 4588
2 TraesCS5D01G556100 chr5D 90.702 1183 104 3 3 1183 559235853 559237031 0 1570
3 TraesCS5D01G556100 chrUn 98.035 2850 53 3 1 2849 306037015 306034168 0 4950
4 TraesCS5D01G556100 chr5B 94.672 2853 140 11 1 2847 693701529 693698683 0 4416
5 TraesCS5D01G556100 chr5B 93.374 2762 165 12 97 2847 693578841 693581595 0 4071
6 TraesCS5D01G556100 chr3A 93.289 2861 159 18 1 2849 743559820 743556981 0 4189
7 TraesCS5D01G556100 chr4A 93.180 2830 165 21 29 2849 612384515 612387325 0 4132
8 TraesCS5D01G556100 chr4A 92.892 2687 163 9 176 2849 612675202 612672531 0 3879
9 TraesCS5D01G556100 chr6B 91.463 1839 130 13 1 1828 234859197 234857375 0 2501
10 TraesCS5D01G556100 chr6B 90.676 1051 71 14 1822 2847 234856326 234855278 0 1373
11 TraesCS5D01G556100 chr6A 91.260 1842 141 11 1 1828 178450855 178449020 0 2492
12 TraesCS5D01G556100 chr3D 91.729 1064 84 4 1 1061 603360168 603361230 0 1474
13 TraesCS5D01G556100 chr3B 90.695 1064 94 5 1 1061 810499080 810498019 0 1411
14 TraesCS5D01G556100 chr6D 90.494 1052 72 16 1822 2847 136706289 136705240 0 1363


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G556100 chr5D 559470850 559473698 2848 True 5262 5262 100.0000 1 2849 1 chr5D.!!$R1 2848
1 TraesCS5D01G556100 chr5D 559356918 559359744 2826 False 4588 4588 95.8700 1 2849 1 chr5D.!!$F2 2848
2 TraesCS5D01G556100 chr5D 559235853 559237031 1178 False 1570 1570 90.7020 3 1183 1 chr5D.!!$F1 1180
3 TraesCS5D01G556100 chrUn 306034168 306037015 2847 True 4950 4950 98.0350 1 2849 1 chrUn.!!$R1 2848
4 TraesCS5D01G556100 chr5B 693698683 693701529 2846 True 4416 4416 94.6720 1 2847 1 chr5B.!!$R1 2846
5 TraesCS5D01G556100 chr5B 693578841 693581595 2754 False 4071 4071 93.3740 97 2847 1 chr5B.!!$F1 2750
6 TraesCS5D01G556100 chr3A 743556981 743559820 2839 True 4189 4189 93.2890 1 2849 1 chr3A.!!$R1 2848
7 TraesCS5D01G556100 chr4A 612384515 612387325 2810 False 4132 4132 93.1800 29 2849 1 chr4A.!!$F1 2820
8 TraesCS5D01G556100 chr4A 612672531 612675202 2671 True 3879 3879 92.8920 176 2849 1 chr4A.!!$R1 2673
9 TraesCS5D01G556100 chr6B 234855278 234859197 3919 True 1937 2501 91.0695 1 2847 2 chr6B.!!$R1 2846
10 TraesCS5D01G556100 chr6A 178449020 178450855 1835 True 2492 2492 91.2600 1 1828 1 chr6A.!!$R1 1827
11 TraesCS5D01G556100 chr3D 603360168 603361230 1062 False 1474 1474 91.7290 1 1061 1 chr3D.!!$F1 1060
12 TraesCS5D01G556100 chr3B 810498019 810499080 1061 True 1411 1411 90.6950 1 1061 1 chr3B.!!$R1 1060
13 TraesCS5D01G556100 chr6D 136705240 136706289 1049 True 1363 1363 90.4940 1822 2847 1 chr6D.!!$R1 1025

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
228 237 3.252974 ACCAGCATTTAGTCTTCCTCG 57.747 47.619 0.0 0.0 0.00 4.63 F
944 967 3.325293 TCTCTCTCAGAATGGTGCAAC 57.675 47.619 0.0 0.0 36.16 4.17 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1293 1326 2.260844 ATACCAGATGCCCATGTTCG 57.739 50.00 0.0 0.0 0.00 3.95 R
2160 3260 9.981460 AGAGGAAGTTTCAACAGGAATAAATAT 57.019 29.63 0.0 0.0 34.91 1.28 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
102 104 3.637911 ATGGGTCATGCTACCGTTTTA 57.362 42.857 0.0 0.0 40.73 1.52
208 217 6.422333 TGTTGCAGATGGGAATCACTTTATA 58.578 36.000 0.0 0.0 0.00 0.98
228 237 3.252974 ACCAGCATTTAGTCTTCCTCG 57.747 47.619 0.0 0.0 0.00 4.63
240 249 3.808174 AGTCTTCCTCGTTGTTTTAGCAC 59.192 43.478 0.0 0.0 0.00 4.40
595 604 8.548877 AGATGTTATTGTTTCCTACTGGTACAT 58.451 33.333 0.0 0.0 38.20 2.29
667 682 7.083858 GTGCTGATTTTGATAACACTGCTTTA 58.916 34.615 0.0 0.0 0.00 1.85
944 967 3.325293 TCTCTCTCAGAATGGTGCAAC 57.675 47.619 0.0 0.0 36.16 4.17
982 1011 9.529325 AAACAAAGGAAAGTAGCAGTTTTATTC 57.471 29.630 0.0 0.0 0.00 1.75
1105 1137 5.495640 AGGATCAAAGGACTTCTTCATGTC 58.504 41.667 0.0 0.0 33.94 3.06
1339 1372 1.865248 GCACACACAGCAGCGAAAATT 60.865 47.619 0.0 0.0 0.00 1.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
102 104 7.661536 TTAGAGACCAGTCAACTATAGCATT 57.338 36.000 0.00 0.00 0.00 3.56
208 217 2.567615 ACGAGGAAGACTAAATGCTGGT 59.432 45.455 0.00 0.00 0.00 4.00
228 237 4.267357 TGTTGTCTCGTGCTAAAACAAC 57.733 40.909 9.16 9.16 46.13 3.32
240 249 3.187227 CACAGGAGGAAATTGTTGTCTCG 59.813 47.826 0.00 0.00 0.00 4.04
619 633 6.756221 ACCAAAGTGAACGTAAGATAAGAGT 58.244 36.000 0.00 0.00 43.62 3.24
667 682 4.760204 GCCAACCTAGAGTAACAACACAAT 59.240 41.667 0.00 0.00 0.00 2.71
944 967 1.490621 CTTTGTTTCAGCGGCCTTTG 58.509 50.000 0.00 0.00 0.00 2.77
982 1011 7.710896 TCATCCATATCATTAGCAGTATCTCG 58.289 38.462 0.00 0.00 0.00 4.04
1105 1137 2.543641 TGAGCTCTGTACATCATTGCG 58.456 47.619 16.19 0.00 32.40 4.85
1148 1180 7.174413 TGGTGGAACATTCTCAGAATTTGATA 58.826 34.615 0.00 0.00 44.52 2.15
1293 1326 2.260844 ATACCAGATGCCCATGTTCG 57.739 50.000 0.00 0.00 0.00 3.95
1339 1372 6.929446 TCCCCTCCCCTTGTTTAATAAATA 57.071 37.500 0.00 0.00 0.00 1.40
2160 3260 9.981460 AGAGGAAGTTTCAACAGGAATAAATAT 57.019 29.630 0.00 0.00 34.91 1.28


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.