Multiple sequence alignment - TraesCS5D01G556000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G556000 chr5D 100.000 2552 0 0 1 2552 559472511 559469960 0.000000e+00 4713.0
1 TraesCS5D01G556000 chr5D 92.904 2593 107 37 1 2552 559358099 559360655 0.000000e+00 3698.0
2 TraesCS5D01G556000 chr5D 91.262 103 8 1 1980 2082 559360048 559360149 3.420000e-29 139.0
3 TraesCS5D01G556000 chrUn 98.224 2083 35 2 1 2082 306035829 306033748 0.000000e+00 3640.0
4 TraesCS5D01G556000 chrUn 97.917 480 10 0 2073 2552 306033722 306033243 0.000000e+00 832.0
5 TraesCS5D01G556000 chr3A 94.299 1912 79 13 1 1905 743558631 743556743 0.000000e+00 2900.0
6 TraesCS5D01G556000 chr3A 96.250 480 17 1 2073 2552 743556577 743556099 0.000000e+00 785.0
7 TraesCS5D01G556000 chr3A 93.706 143 8 1 1940 2082 743556744 743556603 1.990000e-51 213.0
8 TraesCS5D01G556000 chr4A 93.634 1948 96 13 1 1940 612674188 612672261 0.000000e+00 2885.0
9 TraesCS5D01G556000 chr4A 94.279 1783 82 15 2 1781 612385680 612387445 0.000000e+00 2710.0
10 TraesCS5D01G556000 chr4A 94.792 480 25 0 2073 2552 612387744 612388223 0.000000e+00 749.0
11 TraesCS5D01G556000 chr4A 94.421 484 27 0 2069 2552 612672274 612671791 0.000000e+00 745.0
12 TraesCS5D01G556000 chr4A 90.291 103 9 1 1980 2082 612387617 612387718 1.590000e-27 134.0
13 TraesCS5D01G556000 chr5B 95.021 1707 79 6 1 1703 693700343 693698639 0.000000e+00 2676.0
14 TraesCS5D01G556000 chr5B 94.481 1667 83 5 1 1660 693579931 693581595 0.000000e+00 2560.0
15 TraesCS5D01G556000 chr5B 95.077 711 30 4 1845 2552 693698467 693697759 0.000000e+00 1114.0
16 TraesCS5D01G556000 chr5B 95.833 480 20 0 2073 2552 693581823 693582302 0.000000e+00 776.0
17 TraesCS5D01G556000 chr5B 89.796 147 13 2 1936 2082 693581653 693581797 1.210000e-43 187.0
18 TraesCS5D01G556000 chr5B 98.077 52 1 0 1773 1824 693698640 693698589 9.720000e-15 91.6
19 TraesCS5D01G556000 chr6B 90.437 1464 108 18 635 2072 234856326 234854869 0.000000e+00 1899.0
20 TraesCS5D01G556000 chr6B 93.916 641 39 0 1 641 234858015 234857375 0.000000e+00 968.0
21 TraesCS5D01G556000 chr6B 89.474 494 33 5 2073 2548 234854834 234854342 7.810000e-170 606.0
22 TraesCS5D01G556000 chr6D 90.369 1464 109 19 635 2072 136706289 136704832 0.000000e+00 1893.0
23 TraesCS5D01G556000 chr6D 89.676 494 32 5 2073 2548 136704797 136704305 1.680000e-171 612.0
24 TraesCS5D01G556000 chr6A 89.724 1304 96 20 635 1911 178447957 178446665 0.000000e+00 1631.0
25 TraesCS5D01G556000 chr6A 93.604 641 41 0 1 641 178449660 178449020 0.000000e+00 957.0
26 TraesCS5D01G556000 chr6A 84.148 675 71 22 1901 2548 178446483 178445818 2.790000e-174 621.0
27 TraesCS5D01G556000 chr6A 89.583 96 10 0 1977 2072 178446440 178446345 3.450000e-24 122.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G556000 chr5D 559469960 559472511 2551 True 4713.000000 4713 100.000000 1 2552 1 chr5D.!!$R1 2551
1 TraesCS5D01G556000 chr5D 559358099 559360655 2556 False 1918.500000 3698 92.083000 1 2552 2 chr5D.!!$F1 2551
2 TraesCS5D01G556000 chrUn 306033243 306035829 2586 True 2236.000000 3640 98.070500 1 2552 2 chrUn.!!$R1 2551
3 TraesCS5D01G556000 chr3A 743556099 743558631 2532 True 1299.333333 2900 94.751667 1 2552 3 chr3A.!!$R1 2551
4 TraesCS5D01G556000 chr4A 612671791 612674188 2397 True 1815.000000 2885 94.027500 1 2552 2 chr4A.!!$R1 2551
5 TraesCS5D01G556000 chr4A 612385680 612388223 2543 False 1197.666667 2710 93.120667 2 2552 3 chr4A.!!$F1 2550
6 TraesCS5D01G556000 chr5B 693697759 693700343 2584 True 1293.866667 2676 96.058333 1 2552 3 chr5B.!!$R1 2551
7 TraesCS5D01G556000 chr5B 693579931 693582302 2371 False 1174.333333 2560 93.370000 1 2552 3 chr5B.!!$F1 2551
8 TraesCS5D01G556000 chr6B 234854342 234858015 3673 True 1157.666667 1899 91.275667 1 2548 3 chr6B.!!$R1 2547
9 TraesCS5D01G556000 chr6D 136704305 136706289 1984 True 1252.500000 1893 90.022500 635 2548 2 chr6D.!!$R1 1913
10 TraesCS5D01G556000 chr6A 178445818 178449660 3842 True 832.750000 1631 89.264750 1 2548 4 chr6A.!!$R1 2547

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
152 154 1.865248 GCACACACAGCAGCGAAAATT 60.865 47.619 0.0 0.0 0.0 1.82 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2054 3583 2.680339 TCTCACAATGAACGCAACACAA 59.32 40.909 0.0 0.0 0.0 3.33 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
152 154 1.865248 GCACACACAGCAGCGAAAATT 60.865 47.619 0.0 0.00 0.00 1.82
1684 2835 8.378172 ACATAACACATATCCCTGTTTTATCG 57.622 34.615 0.0 0.00 32.42 2.92
1960 3455 5.752036 ATCTGTGGAGACAAGATTCTTGA 57.248 39.130 28.6 6.98 46.06 3.02
2066 3595 2.774439 AAGGATGTTGTGTTGCGTTC 57.226 45.000 0.0 0.00 0.00 3.95
2067 3596 1.674359 AGGATGTTGTGTTGCGTTCA 58.326 45.000 0.0 0.00 0.00 3.18
2536 4117 6.346598 GCGTTTAATTTCCTTTTTCTGGCTTC 60.347 38.462 0.0 0.00 0.00 3.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
106 108 2.260844 ATACCAGATGCCCATGTTCG 57.739 50.000 0.0 0.0 0.00 3.95
152 154 6.929446 TCCCCTCCCCTTGTTTAATAAATA 57.071 37.500 0.0 0.0 0.00 1.40
973 2066 9.981460 AGAGGAAGTTTCAACAGGAATAAATAT 57.019 29.630 0.0 0.0 34.91 1.28
1840 3124 9.497030 GCAGAGTCTCGTAACTGATTATATATG 57.503 37.037 0.0 0.0 32.90 1.78
1960 3455 5.945144 ATCTCCAGCCAAATAAGCAAAAT 57.055 34.783 0.0 0.0 0.00 1.82
2054 3583 2.680339 TCTCACAATGAACGCAACACAA 59.320 40.909 0.0 0.0 0.00 3.33
2369 3949 2.553466 CCCATTCTGGTGGTTTTCGGTA 60.553 50.000 0.0 0.0 37.57 4.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.