Multiple sequence alignment - TraesCS5D01G539400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G539400 chr5D 100.000 2407 0 0 1 2407 551022902 551020496 0.000000e+00 4446.0
1 TraesCS5D01G539400 chr5D 95.304 1725 32 17 715 2407 254535455 254533748 0.000000e+00 2691.0
2 TraesCS5D01G539400 chr5D 97.357 719 17 2 1 717 254536572 254535854 0.000000e+00 1221.0
3 TraesCS5D01G539400 chr7D 96.928 1725 19 6 715 2407 509916107 509914385 0.000000e+00 2861.0
4 TraesCS5D01G539400 chr7D 96.932 717 20 1 1 717 509917138 509916424 0.000000e+00 1201.0
5 TraesCS5D01G539400 chr2A 97.048 1694 38 5 724 2407 721732797 721734488 0.000000e+00 2841.0
6 TraesCS5D01G539400 chr2A 95.317 961 14 11 1453 2407 195111437 195112372 0.000000e+00 1496.0
7 TraesCS5D01G539400 chr2A 96.234 717 25 1 1 717 721731674 721732388 0.000000e+00 1173.0
8 TraesCS5D01G539400 chr2A 96.979 629 18 1 715 1343 195110437 195111064 0.000000e+00 1055.0
9 TraesCS5D01G539400 chr7A 95.814 1696 33 7 724 2407 678173856 678172187 0.000000e+00 2704.0
10 TraesCS5D01G539400 chr7A 96.513 717 24 1 1 717 678174978 678174263 0.000000e+00 1184.0
11 TraesCS5D01G539400 chr1A 97.330 1086 15 6 1335 2407 14530328 14529244 0.000000e+00 1832.0
12 TraesCS5D01G539400 chr1A 97.297 629 16 1 715 1343 14530994 14530367 0.000000e+00 1066.0
13 TraesCS5D01G539400 chr1A 93.007 715 20 10 1 715 14532079 14531395 0.000000e+00 1016.0
14 TraesCS5D01G539400 chr4D 96.916 908 6 4 1508 2407 40829854 40830747 0.000000e+00 1502.0
15 TraesCS5D01G539400 chr4D 96.566 728 22 2 1 725 40828032 40828759 0.000000e+00 1203.0
16 TraesCS5D01G539400 chr4D 97.138 629 17 1 715 1343 40829149 40829776 0.000000e+00 1061.0
17 TraesCS5D01G539400 chr4D 86.084 618 73 6 716 1333 315816947 315817551 0.000000e+00 652.0
18 TraesCS5D01G539400 chr4D 87.324 71 8 1 645 715 197775302 197775371 1.980000e-11 80.5
19 TraesCS5D01G539400 chr1B 94.888 978 21 9 715 1665 154145566 154146541 0.000000e+00 1502.0
20 TraesCS5D01G539400 chr1B 95.213 961 15 11 1453 2407 154146541 154147476 0.000000e+00 1491.0
21 TraesCS5D01G539400 chr1B 89.327 431 26 7 1994 2407 55536878 55536451 7.620000e-145 523.0
22 TraesCS5D01G539400 chr3A 93.490 722 39 5 1 717 365957651 365956933 0.000000e+00 1066.0
23 TraesCS5D01G539400 chr2D 93.075 722 41 4 1 717 361711292 361712009 0.000000e+00 1048.0
24 TraesCS5D01G539400 chr1D 90.868 657 42 10 1332 1976 479501988 479502638 0.000000e+00 865.0
25 TraesCS5D01G539400 chrUn 90.152 660 47 11 1332 1979 260016889 260016236 0.000000e+00 843.0
26 TraesCS5D01G539400 chrUn 99.156 237 2 0 2171 2407 480831434 480831198 6.150000e-116 427.0
27 TraesCS5D01G539400 chr2B 87.117 652 69 7 1 640 131077500 131078148 0.000000e+00 725.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G539400 chr5D 551020496 551022902 2406 True 4446.000000 4446 100.000000 1 2407 1 chr5D.!!$R1 2406
1 TraesCS5D01G539400 chr5D 254533748 254536572 2824 True 1956.000000 2691 96.330500 1 2407 2 chr5D.!!$R2 2406
2 TraesCS5D01G539400 chr7D 509914385 509917138 2753 True 2031.000000 2861 96.930000 1 2407 2 chr7D.!!$R1 2406
3 TraesCS5D01G539400 chr2A 721731674 721734488 2814 False 2007.000000 2841 96.641000 1 2407 2 chr2A.!!$F2 2406
4 TraesCS5D01G539400 chr2A 195110437 195112372 1935 False 1275.500000 1496 96.148000 715 2407 2 chr2A.!!$F1 1692
5 TraesCS5D01G539400 chr7A 678172187 678174978 2791 True 1944.000000 2704 96.163500 1 2407 2 chr7A.!!$R1 2406
6 TraesCS5D01G539400 chr1A 14529244 14532079 2835 True 1304.666667 1832 95.878000 1 2407 3 chr1A.!!$R1 2406
7 TraesCS5D01G539400 chr4D 40828032 40830747 2715 False 1255.333333 1502 96.873333 1 2407 3 chr4D.!!$F3 2406
8 TraesCS5D01G539400 chr4D 315816947 315817551 604 False 652.000000 652 86.084000 716 1333 1 chr4D.!!$F2 617
9 TraesCS5D01G539400 chr1B 154145566 154147476 1910 False 1496.500000 1502 95.050500 715 2407 2 chr1B.!!$F1 1692
10 TraesCS5D01G539400 chr3A 365956933 365957651 718 True 1066.000000 1066 93.490000 1 717 1 chr3A.!!$R1 716
11 TraesCS5D01G539400 chr2D 361711292 361712009 717 False 1048.000000 1048 93.075000 1 717 1 chr2D.!!$F1 716
12 TraesCS5D01G539400 chr1D 479501988 479502638 650 False 865.000000 865 90.868000 1332 1976 1 chr1D.!!$F1 644
13 TraesCS5D01G539400 chrUn 260016236 260016889 653 True 843.000000 843 90.152000 1332 1979 1 chrUn.!!$R1 647
14 TraesCS5D01G539400 chr2B 131077500 131078148 648 False 725.000000 725 87.117000 1 640 1 chr2B.!!$F1 639

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
772 1271 1.212935 CCACTCCACCAAATCCCTAGG 59.787 57.143 0.06 0.06 0.0 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1951 2736 0.317479 GAAGTCGTAGGTGCTGGTGT 59.683 55.0 0.0 0.0 0.0 4.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
418 425 4.586001 ACTTTGACAAGATTGTTGCATCCT 59.414 37.500 0.00 0.00 42.43 3.24
772 1271 1.212935 CCACTCCACCAAATCCCTAGG 59.787 57.143 0.06 0.06 0.00 3.02
1056 1555 1.152963 AGTGCCTTGTTGGACGCTT 60.153 52.632 0.00 0.00 38.35 4.68
1067 1566 1.742768 GGACGCTTCCATCTCCGAT 59.257 57.895 3.96 0.00 42.30 4.18
1209 1708 4.703379 CAATCTCTGGAGCCTAGGATTT 57.297 45.455 14.75 0.00 0.00 2.17
1224 1723 0.904649 GATTTGGGGAAAGGCAAGGG 59.095 55.000 0.00 0.00 0.00 3.95
1321 1820 2.123854 TCTCTGCCGCGGGAGTAT 60.124 61.111 40.18 0.00 35.04 2.12
1941 2726 0.540923 GAGAAGATGGTGCCTGCTCT 59.459 55.000 0.00 0.00 34.24 4.09
1951 2736 0.906775 TGCCTGCTCTGTGATGATGA 59.093 50.000 0.00 0.00 0.00 2.92
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
3 4 6.263168 TCTGAAGAAGAAGTTGGTGAATTTCC 59.737 38.462 0.00 0.00 30.03 3.13
183 190 1.108727 CCAGTGGTGTGGTGTTGCAT 61.109 55.000 0.00 0.00 32.32 3.96
238 245 2.027192 TGGAGTTCCAATAGACTGCACC 60.027 50.000 0.00 0.00 44.35 5.01
280 287 3.445008 ACATCTCCTGAAGCTCCAAGTA 58.555 45.455 0.00 0.00 0.00 2.24
364 371 4.681074 TCCTTTGTTTCCAAATGTTCCC 57.319 40.909 0.00 0.00 39.72 3.97
418 425 6.003326 TGAGTGCTCTTTTCCAATCATACAA 58.997 36.000 0.68 0.00 31.97 2.41
650 666 8.674263 AAAAACAACATTCCTGATATTTTGCA 57.326 26.923 0.00 0.00 0.00 4.08
718 734 1.257743 TGAGCGTGAAGAGGCTAACT 58.742 50.000 0.00 0.00 43.38 2.24
719 735 2.301577 ATGAGCGTGAAGAGGCTAAC 57.698 50.000 0.00 0.00 43.38 2.34
722 738 0.107945 GGAATGAGCGTGAAGAGGCT 60.108 55.000 0.00 0.00 46.01 4.58
1056 1555 1.444672 CAGCAGCATCGGAGATGGA 59.555 57.895 11.41 0.00 45.12 3.41
1067 1566 2.351244 CGGAGGAGTACCAGCAGCA 61.351 63.158 0.00 0.00 38.94 4.41
1209 1708 2.453497 TCCCCTTGCCTTTCCCCA 60.453 61.111 0.00 0.00 0.00 4.96
1224 1723 3.118482 TCACAATCAGCTCCAGAATCTCC 60.118 47.826 0.00 0.00 0.00 3.71
1321 1820 1.466856 CAGCAGCAGCCTTTCCAATA 58.533 50.000 0.00 0.00 43.56 1.90
1941 2726 1.611410 GGTGCTGGTGTCATCATCACA 60.611 52.381 19.01 1.65 37.52 3.58
1951 2736 0.317479 GAAGTCGTAGGTGCTGGTGT 59.683 55.000 0.00 0.00 0.00 4.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.