Multiple sequence alignment - TraesCS5D01G522800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G522800 chr5D 100.000 2513 0 0 1 2513 543174275 543176787 0 4641
1 TraesCS5D01G522800 chr5D 97.320 2500 54 12 1 2492 411862989 411860495 0 4233
2 TraesCS5D01G522800 chr4D 97.934 2517 47 4 1 2513 9843254 9845769 0 4355
3 TraesCS5D01G522800 chr4D 97.477 2497 54 9 1 2492 403260740 403263232 0 4253
4 TraesCS5D01G522800 chr4D 97.502 2482 53 8 1 2478 167162842 167160366 0 4231
5 TraesCS5D01G522800 chr1D 98.028 2485 37 10 1 2478 78958016 78960495 0 4307
6 TraesCS5D01G522800 chr6D 97.499 2519 52 9 1 2513 77570295 77572808 0 4292
7 TraesCS5D01G522800 chr3D 97.478 2498 48 12 1 2492 357389677 357392165 0 4250
8 TraesCS5D01G522800 chr2D 97.162 2502 58 7 1 2492 118670698 118668200 0 4215
9 TraesCS5D01G522800 chr2D 97.194 2495 60 6 1 2492 76712779 76715266 0 4211


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G522800 chr5D 543174275 543176787 2512 False 4641 4641 100.000 1 2513 1 chr5D.!!$F1 2512
1 TraesCS5D01G522800 chr5D 411860495 411862989 2494 True 4233 4233 97.320 1 2492 1 chr5D.!!$R1 2491
2 TraesCS5D01G522800 chr4D 9843254 9845769 2515 False 4355 4355 97.934 1 2513 1 chr4D.!!$F1 2512
3 TraesCS5D01G522800 chr4D 403260740 403263232 2492 False 4253 4253 97.477 1 2492 1 chr4D.!!$F2 2491
4 TraesCS5D01G522800 chr4D 167160366 167162842 2476 True 4231 4231 97.502 1 2478 1 chr4D.!!$R1 2477
5 TraesCS5D01G522800 chr1D 78958016 78960495 2479 False 4307 4307 98.028 1 2478 1 chr1D.!!$F1 2477
6 TraesCS5D01G522800 chr6D 77570295 77572808 2513 False 4292 4292 97.499 1 2513 1 chr6D.!!$F1 2512
7 TraesCS5D01G522800 chr3D 357389677 357392165 2488 False 4250 4250 97.478 1 2492 1 chr3D.!!$F1 2491
8 TraesCS5D01G522800 chr2D 118668200 118670698 2498 True 4215 4215 97.162 1 2492 1 chr2D.!!$R1 2491
9 TraesCS5D01G522800 chr2D 76712779 76715266 2487 False 4211 4211 97.194 1 2492 1 chr2D.!!$F1 2491

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
552 559 1.389609 GCCGTCGGATCCTACCAAGA 61.39 60.0 17.49 0.0 0.0 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1808 1819 0.879765 GAACTGACGAACTCGAGGGA 59.12 55.0 18.41 0.0 43.02 4.2 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
127 130 7.021812 ACCCTAAACCCTCTCTCCCTATTATAT 59.978 40.741 0.00 0.00 0.00 0.86
258 263 3.623060 CGGCTATGTGCACAAGAATTACT 59.377 43.478 25.72 7.12 45.15 2.24
262 267 6.456988 GGCTATGTGCACAAGAATTACTACAC 60.457 42.308 25.72 2.06 45.15 2.90
552 559 1.389609 GCCGTCGGATCCTACCAAGA 61.390 60.000 17.49 0.00 0.00 3.02
753 761 8.900983 AACTACAAAATACAATGTGGCAAATT 57.099 26.923 0.00 0.00 31.91 1.82
790 798 2.102925 CCTTCTCCTCTTCTCCATCTGC 59.897 54.545 0.00 0.00 0.00 4.26
1540 1551 5.825679 TGTTTGTCTATAGTTGTTGCCACTT 59.174 36.000 0.00 0.00 0.00 3.16
1808 1819 2.165437 TCTCGCACTTGCCAAACTTTTT 59.835 40.909 0.00 0.00 37.91 1.94
1809 1820 2.535331 TCGCACTTGCCAAACTTTTTC 58.465 42.857 0.00 0.00 37.91 2.29
2376 2403 6.612049 AGTTAGTTTGGTTAATTTTCCCCACA 59.388 34.615 0.00 0.00 0.00 4.17
2396 2423 4.394920 CACACCAATTAGCCGTGTCTAAAT 59.605 41.667 0.00 0.00 38.65 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
334 340 5.757988 ACTCGGTATAGGGGCATTTTTAAA 58.242 37.500 0.00 0.00 0.00 1.52
335 341 5.376756 ACTCGGTATAGGGGCATTTTTAA 57.623 39.130 0.00 0.00 0.00 1.52
336 342 5.376756 AACTCGGTATAGGGGCATTTTTA 57.623 39.130 0.00 0.00 0.00 1.52
439 446 5.127519 TGACCAGATTTCAAATGGCCATAAG 59.872 40.000 21.15 14.81 37.64 1.73
552 559 2.203294 GACGGGTGGTGTTTGGCT 60.203 61.111 0.00 0.00 0.00 4.75
753 761 4.348168 GGAGAAGGGGAAGCTATATTGACA 59.652 45.833 0.00 0.00 0.00 3.58
790 798 0.674581 TGCTCGATGCCTTTGTCTGG 60.675 55.000 4.73 0.00 42.00 3.86
1540 1551 8.635765 AGATAAACAGACTTGGATTGCTAAAA 57.364 30.769 0.00 0.00 0.00 1.52
1808 1819 0.879765 GAACTGACGAACTCGAGGGA 59.120 55.000 18.41 0.00 43.02 4.20
1809 1820 0.882474 AGAACTGACGAACTCGAGGG 59.118 55.000 18.41 8.10 43.02 4.30
2376 2403 5.105917 CCAAATTTAGACACGGCTAATTGGT 60.106 40.000 13.57 0.00 36.57 3.67
2396 2423 9.838339 ATATGTTTGTATTTTGTTTGTCCCAAA 57.162 25.926 0.00 0.00 0.00 3.28


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.