Multiple sequence alignment - TraesCS5D01G517300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G517300 chr5D 100.000 3265 0 0 1 3265 539389233 539385969 0 6030
1 TraesCS5D01G517300 chr7D 97.063 3269 92 3 1 3265 518129534 518132802 0 5502
2 TraesCS5D01G517300 chr7D 96.420 3268 112 4 1 3265 610300220 610303485 0 5382
3 TraesCS5D01G517300 chr3D 97.090 3265 91 3 4 3265 335959059 335955796 0 5500
4 TraesCS5D01G517300 chr6D 97.035 3272 89 5 1 3265 411365375 411362105 0 5498
5 TraesCS5D01G517300 chr2D 96.911 3270 96 3 1 3265 536061447 536058178 0 5474
6 TraesCS5D01G517300 chr2D 96.544 3270 108 3 1 3265 534899900 534896631 0 5408
7 TraesCS5D01G517300 chr1D 96.667 3270 101 4 4 3265 366430891 366427622 0 5428
8 TraesCS5D01G517300 chr1D 96.456 3273 108 5 1 3265 466162871 466166143 0 5395
9 TraesCS5D01G517300 chr2A 94.924 3270 159 5 1 3265 307022429 307019162 0 5112


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G517300 chr5D 539385969 539389233 3264 True 6030 6030 100.000 1 3265 1 chr5D.!!$R1 3264
1 TraesCS5D01G517300 chr7D 518129534 518132802 3268 False 5502 5502 97.063 1 3265 1 chr7D.!!$F1 3264
2 TraesCS5D01G517300 chr7D 610300220 610303485 3265 False 5382 5382 96.420 1 3265 1 chr7D.!!$F2 3264
3 TraesCS5D01G517300 chr3D 335955796 335959059 3263 True 5500 5500 97.090 4 3265 1 chr3D.!!$R1 3261
4 TraesCS5D01G517300 chr6D 411362105 411365375 3270 True 5498 5498 97.035 1 3265 1 chr6D.!!$R1 3264
5 TraesCS5D01G517300 chr2D 536058178 536061447 3269 True 5474 5474 96.911 1 3265 1 chr2D.!!$R2 3264
6 TraesCS5D01G517300 chr2D 534896631 534899900 3269 True 5408 5408 96.544 1 3265 1 chr2D.!!$R1 3264
7 TraesCS5D01G517300 chr1D 366427622 366430891 3269 True 5428 5428 96.667 4 3265 1 chr1D.!!$R1 3261
8 TraesCS5D01G517300 chr1D 466162871 466166143 3272 False 5395 5395 96.456 1 3265 1 chr1D.!!$F1 3264
9 TraesCS5D01G517300 chr2A 307019162 307022429 3267 True 5112 5112 94.924 1 3265 1 chr2A.!!$R1 3264

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
764 773 0.034756 GGTTGCTTTTTCCCGGCAAT 59.965 50.0 0.0 0.0 45.55 3.56 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2295 2313 4.362279 ACAAGCATAAACACAAGCAACTG 58.638 39.13 0.0 0.0 0.0 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
98 99 1.599606 TTTGTGTTGTTGGGCGCACT 61.600 50.000 12.74 0.00 33.44 4.40
437 445 1.063469 GGCACCGACGTTGGAATTATG 59.937 52.381 29.00 16.16 0.00 1.90
545 553 5.009310 TGTGAAGTCTTTAGAGTTACGAGCA 59.991 40.000 0.00 0.00 37.79 4.26
721 729 3.608073 GGTGCGAGCAATAACATTTGTTC 59.392 43.478 0.00 0.00 39.31 3.18
764 773 0.034756 GGTTGCTTTTTCCCGGCAAT 59.965 50.000 0.00 0.00 45.55 3.56
1045 1056 3.299977 CCCGTGGTGAGACGTCCA 61.300 66.667 13.01 7.31 37.66 4.02
1209 1220 1.292242 AGCAGGATCCTGAAGAGGGTA 59.708 52.381 40.29 0.00 46.30 3.69
1293 1304 0.978146 AGAGGGCAGCGGTTCTACAT 60.978 55.000 0.00 0.00 0.00 2.29
1337 1348 1.271379 GGTATATCACATCACCGCGGA 59.729 52.381 35.90 11.57 0.00 5.54
2177 2195 0.736636 CATACGCCACCTACGAGTCA 59.263 55.000 0.00 0.00 0.00 3.41
2295 2313 4.483476 AAACATAGAAAACTGGTCGTGC 57.517 40.909 0.00 0.00 0.00 5.34
2508 2526 9.118236 GTGATTTTGAAGTAGTAATGTTGCTTC 57.882 33.333 0.00 0.00 36.89 3.86
2650 2668 0.820891 AGGCACAGGTTTGCAGTCTG 60.821 55.000 10.24 10.24 44.94 3.51
2814 2832 0.871057 GGAAGTGTGCAGAGTCAAGC 59.129 55.000 0.00 0.00 0.00 4.01
2999 3018 4.256920 GGTTAGAGATGCACTGTTGTGAT 58.743 43.478 0.00 0.00 46.55 3.06
3168 3187 5.452078 TCAATCCTGTGGATGTTCAAAAC 57.548 39.130 0.00 0.00 42.27 2.43
3187 3206 2.191400 ACTGTGATACCAGAGGCATGT 58.809 47.619 0.00 0.00 37.94 3.21
3191 3210 3.264193 TGTGATACCAGAGGCATGTTTCT 59.736 43.478 0.00 0.00 0.00 2.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
33 34 4.250305 ACTTCAACACCGCCGGCT 62.250 61.111 26.68 2.78 0.00 5.52
98 99 2.293955 TCGAGATACACACCGTCAAACA 59.706 45.455 0.00 0.00 0.00 2.83
437 445 1.834263 AGAGTTCATACCAGTGCCTCC 59.166 52.381 0.00 0.00 0.00 4.30
992 1003 2.622903 TTCCTCCGCCATTACGCTCG 62.623 60.000 0.00 0.00 0.00 5.03
1045 1056 2.932234 CGACCTCGGTGCTCTGGTT 61.932 63.158 0.00 0.00 35.37 3.67
1129 1140 2.554032 CGACATCCAGCTTTTCCTTGTT 59.446 45.455 0.00 0.00 0.00 2.83
1168 1179 2.237143 TGATCATCTTGTCGGCTTCCTT 59.763 45.455 0.00 0.00 0.00 3.36
1209 1220 1.221840 CTGAGGGTACAAGCCGCAT 59.778 57.895 2.06 0.00 44.21 4.73
1234 1245 2.686405 TGGTATACTCGACATCAACGCT 59.314 45.455 2.25 0.00 0.00 5.07
1293 1304 2.301870 ACAGAGTTCCTCCACGCATAAA 59.698 45.455 0.00 0.00 0.00 1.40
2177 2195 7.886970 TCTCTGATGTTTTCAATTCTCTTCCAT 59.113 33.333 0.00 0.00 32.78 3.41
2295 2313 4.362279 ACAAGCATAAACACAAGCAACTG 58.638 39.130 0.00 0.00 0.00 3.16
2814 2832 2.334946 CCCCATGGTGTCGCACAAG 61.335 63.158 11.73 0.00 35.86 3.16
2999 3018 2.229792 GCCCATGTCTCTTCACAAACA 58.770 47.619 0.00 0.00 0.00 2.83
3030 3049 0.108329 CCCGCGACTCTTACATGGTT 60.108 55.000 8.23 0.00 0.00 3.67
3168 3187 2.996249 ACATGCCTCTGGTATCACAG 57.004 50.000 0.00 0.00 39.84 3.66
3187 3206 4.222145 ACTCCCTAACTGCGTATTCAGAAA 59.778 41.667 0.00 0.00 37.51 2.52
3191 3210 3.093814 TGACTCCCTAACTGCGTATTCA 58.906 45.455 0.00 0.00 0.00 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.