Multiple sequence alignment - TraesCS5D01G488600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G488600 chr5D 100.000 3713 0 0 1 3713 523940965 523937253 0.000000e+00 6857.0
1 TraesCS5D01G488600 chr5D 99.515 3713 18 0 1 3713 523994802 523991090 0.000000e+00 6758.0
2 TraesCS5D01G488600 chr5D 90.025 802 79 1 1 801 423231974 423231173 0.000000e+00 1037.0
3 TraesCS5D01G488600 chr5D 89.798 794 77 4 10 801 464702704 464701913 0.000000e+00 1014.0
4 TraesCS5D01G488600 chr5D 96.154 52 2 0 3660 3711 517517685 517517634 6.610000e-13 86.1
5 TraesCS5D01G488600 chr7D 90.387 801 76 1 1 801 478798863 478799662 0.000000e+00 1051.0
6 TraesCS5D01G488600 chr7D 89.277 802 85 1 1 801 611664839 611665640 0.000000e+00 1003.0
7 TraesCS5D01G488600 chr7D 86.575 581 67 5 3083 3662 556547398 556546828 6.770000e-177 630.0
8 TraesCS5D01G488600 chr2D 89.937 795 76 2 7 801 290747076 290746286 0.000000e+00 1022.0
9 TraesCS5D01G488600 chr2D 83.350 997 164 2 1708 2703 617052672 617053667 0.000000e+00 920.0
10 TraesCS5D01G488600 chr2D 89.347 582 55 6 3083 3662 15913221 15912645 0.000000e+00 725.0
11 TraesCS5D01G488600 chr2D 79.095 995 195 12 1708 2696 540951168 540952155 0.000000e+00 673.0
12 TraesCS5D01G488600 chr1B 89.500 800 78 4 1 798 94009172 94009967 0.000000e+00 1007.0
13 TraesCS5D01G488600 chr1B 84.865 185 28 0 1008 1192 28586396 28586212 1.760000e-43 187.0
14 TraesCS5D01G488600 chr2B 89.277 802 85 1 1 801 593662337 593663138 0.000000e+00 1003.0
15 TraesCS5D01G488600 chr2B 89.250 800 79 5 1 798 452910217 452911011 0.000000e+00 994.0
16 TraesCS5D01G488600 chr2B 83.000 1000 168 2 1708 2706 752786773 752787771 0.000000e+00 904.0
17 TraesCS5D01G488600 chrUn 100.000 405 0 0 2763 3167 478238501 478238905 0.000000e+00 749.0
18 TraesCS5D01G488600 chrUn 87.780 581 67 3 3083 3662 15658075 15658652 0.000000e+00 676.0
19 TraesCS5D01G488600 chrUn 87.608 581 68 3 3083 3662 329232130 329231553 0.000000e+00 671.0
20 TraesCS5D01G488600 chr6B 86.600 597 62 9 3071 3662 205232785 205232202 0.000000e+00 643.0
21 TraesCS5D01G488600 chr3B 85.835 593 75 7 3071 3662 38712348 38711764 4.070000e-174 621.0
22 TraesCS5D01G488600 chr2A 86.340 571 75 3 3092 3662 764764715 764764148 1.460000e-173 619.0
23 TraesCS5D01G488600 chr2A 79.510 449 89 3 2250 2696 684400970 684401417 2.150000e-82 316.0
24 TraesCS5D01G488600 chr6D 85.279 591 79 7 3069 3657 6728222 6728806 1.480000e-168 603.0
25 TraesCS5D01G488600 chr1A 84.000 200 30 2 1008 1206 20984999 20984801 1.360000e-44 191.0
26 TraesCS5D01G488600 chr1A 96.154 52 2 0 3660 3711 45570185 45570236 6.610000e-13 86.1
27 TraesCS5D01G488600 chr1A 96.154 52 2 0 3660 3711 502609077 502609026 6.610000e-13 86.1
28 TraesCS5D01G488600 chr1D 83.770 191 30 1 1008 1197 19137049 19136859 2.950000e-41 180.0
29 TraesCS5D01G488600 chr1D 98.077 52 1 0 3660 3711 28329532 28329583 1.420000e-14 91.6
30 TraesCS5D01G488600 chr1D 96.154 52 2 0 3660 3711 3079963 3079912 6.610000e-13 86.1
31 TraesCS5D01G488600 chr7B 100.000 52 0 0 3660 3711 473418514 473418565 3.050000e-16 97.1
32 TraesCS5D01G488600 chr4B 98.077 52 1 0 3660 3711 407004053 407004104 1.420000e-14 91.6
33 TraesCS5D01G488600 chr3D 98.077 52 1 0 3660 3711 509073539 509073488 1.420000e-14 91.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G488600 chr5D 523937253 523940965 3712 True 6857 6857 100.000 1 3713 1 chr5D.!!$R4 3712
1 TraesCS5D01G488600 chr5D 523991090 523994802 3712 True 6758 6758 99.515 1 3713 1 chr5D.!!$R5 3712
2 TraesCS5D01G488600 chr5D 423231173 423231974 801 True 1037 1037 90.025 1 801 1 chr5D.!!$R1 800
3 TraesCS5D01G488600 chr5D 464701913 464702704 791 True 1014 1014 89.798 10 801 1 chr5D.!!$R2 791
4 TraesCS5D01G488600 chr7D 478798863 478799662 799 False 1051 1051 90.387 1 801 1 chr7D.!!$F1 800
5 TraesCS5D01G488600 chr7D 611664839 611665640 801 False 1003 1003 89.277 1 801 1 chr7D.!!$F2 800
6 TraesCS5D01G488600 chr7D 556546828 556547398 570 True 630 630 86.575 3083 3662 1 chr7D.!!$R1 579
7 TraesCS5D01G488600 chr2D 290746286 290747076 790 True 1022 1022 89.937 7 801 1 chr2D.!!$R2 794
8 TraesCS5D01G488600 chr2D 617052672 617053667 995 False 920 920 83.350 1708 2703 1 chr2D.!!$F2 995
9 TraesCS5D01G488600 chr2D 15912645 15913221 576 True 725 725 89.347 3083 3662 1 chr2D.!!$R1 579
10 TraesCS5D01G488600 chr2D 540951168 540952155 987 False 673 673 79.095 1708 2696 1 chr2D.!!$F1 988
11 TraesCS5D01G488600 chr1B 94009172 94009967 795 False 1007 1007 89.500 1 798 1 chr1B.!!$F1 797
12 TraesCS5D01G488600 chr2B 593662337 593663138 801 False 1003 1003 89.277 1 801 1 chr2B.!!$F2 800
13 TraesCS5D01G488600 chr2B 452910217 452911011 794 False 994 994 89.250 1 798 1 chr2B.!!$F1 797
14 TraesCS5D01G488600 chr2B 752786773 752787771 998 False 904 904 83.000 1708 2706 1 chr2B.!!$F3 998
15 TraesCS5D01G488600 chrUn 15658075 15658652 577 False 676 676 87.780 3083 3662 1 chrUn.!!$F1 579
16 TraesCS5D01G488600 chrUn 329231553 329232130 577 True 671 671 87.608 3083 3662 1 chrUn.!!$R1 579
17 TraesCS5D01G488600 chr6B 205232202 205232785 583 True 643 643 86.600 3071 3662 1 chr6B.!!$R1 591
18 TraesCS5D01G488600 chr3B 38711764 38712348 584 True 621 621 85.835 3071 3662 1 chr3B.!!$R1 591
19 TraesCS5D01G488600 chr2A 764764148 764764715 567 True 619 619 86.340 3092 3662 1 chr2A.!!$R1 570
20 TraesCS5D01G488600 chr6D 6728222 6728806 584 False 603 603 85.279 3069 3657 1 chr6D.!!$F1 588

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
102 103 2.118732 TCACCTGCCTCCGGTACA 59.881 61.111 0.00 0.0 32.37 2.90 F
1250 1256 2.736719 GCGACTGATGCATGTGAGTACT 60.737 50.000 2.46 0.0 0.00 2.73 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1250 1256 1.065551 CATCAGTCGCGTGATCCACTA 59.934 52.381 5.77 0.0 34.81 2.74 R
2761 2768 5.278660 GCAAGGATTATGCATTCGAGGAAAT 60.279 40.000 3.54 0.0 43.29 2.17 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
76 77 5.692204 ACAGAACATCTCTAAACTTGACACG 59.308 40.000 0.00 0.0 31.12 4.49
102 103 2.118732 TCACCTGCCTCCGGTACA 59.881 61.111 0.00 0.0 32.37 2.90
1250 1256 2.736719 GCGACTGATGCATGTGAGTACT 60.737 50.000 2.46 0.0 0.00 2.73
2761 2768 4.634004 CGTCACCACAATAATCCTTGCTAA 59.366 41.667 0.00 0.0 0.00 3.09
3689 3702 3.372954 GACATCGTCGATTTCTTCCGAT 58.627 45.455 12.99 0.0 38.68 4.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
67 68 1.143183 ACAGGCGTTCGTGTCAAGT 59.857 52.632 0.00 0.00 36.69 3.16
76 77 3.050275 GGCAGGTGACAGGCGTTC 61.050 66.667 0.00 0.00 34.15 3.95
102 103 1.072806 TCTTCTGTGGCTGCTGTGATT 59.927 47.619 0.00 0.00 0.00 2.57
1250 1256 1.065551 CATCAGTCGCGTGATCCACTA 59.934 52.381 5.77 0.00 34.81 2.74
1338 1344 8.637196 TGATGGAACTTCAGAGATACGTATAT 57.363 34.615 8.34 4.96 0.00 0.86
2761 2768 5.278660 GCAAGGATTATGCATTCGAGGAAAT 60.279 40.000 3.54 0.00 43.29 2.17
3689 3702 5.957798 CATTCTTTCTTAAGGCATGCTTGA 58.042 37.500 18.92 0.00 32.02 3.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.