Multiple sequence alignment - TraesCS5D01G488400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G488400 chr5D 100.000 3292 0 0 1 3292 523315724 523312433 0.000000e+00 6080.0
1 TraesCS5D01G488400 chr5D 99.333 3296 15 6 1 3292 523188536 523185244 0.000000e+00 5958.0
2 TraesCS5D01G488400 chr5D 94.833 329 15 2 2494 2821 522640261 522639934 2.270000e-141 512.0
3 TraesCS5D01G488400 chr5D 82.667 75 12 1 1 75 212007737 212007810 7.620000e-07 65.8
4 TraesCS5D01G488400 chr5D 86.441 59 8 0 4 62 315213066 315213008 7.620000e-07 65.8
5 TraesCS5D01G488400 chrUn 98.004 1102 18 3 2192 3292 199132292 199133390 0.000000e+00 1910.0
6 TraesCS5D01G488400 chrUn 97.731 1102 21 3 2192 3292 352764321 352765419 0.000000e+00 1893.0
7 TraesCS5D01G488400 chrUn 99.283 697 3 2 1495 2190 199131471 199132166 0.000000e+00 1258.0
8 TraesCS5D01G488400 chrUn 98.826 596 7 0 1 596 199129963 199130558 0.000000e+00 1062.0
9 TraesCS5D01G488400 chrUn 98.826 596 7 0 1 596 319376734 319377329 0.000000e+00 1062.0
10 TraesCS5D01G488400 chr1A 84.178 1599 205 29 873 2456 522536008 522534443 0.000000e+00 1507.0
11 TraesCS5D01G488400 chr1A 82.105 1615 237 40 938 2535 522510878 522509299 0.000000e+00 1334.0
12 TraesCS5D01G488400 chr1A 81.328 1596 243 34 770 2346 522516518 522514959 0.000000e+00 1245.0
13 TraesCS5D01G488400 chr1D 84.630 1529 195 23 941 2456 427372342 427370841 0.000000e+00 1485.0
14 TraesCS5D01G488400 chr1D 83.748 1526 210 34 987 2506 427332212 427330719 0.000000e+00 1410.0
15 TraesCS5D01G488400 chr1D 81.109 1731 267 45 822 2535 427319645 427317958 0.000000e+00 1330.0
16 TraesCS5D01G488400 chr1D 80.654 1437 202 45 446 1837 427597443 427596038 0.000000e+00 1044.0
17 TraesCS5D01G488400 chr1B 85.051 1485 180 21 999 2473 577913101 577911649 0.000000e+00 1474.0
18 TraesCS5D01G488400 chr1B 82.813 1571 232 29 838 2392 578045553 578044005 0.000000e+00 1371.0
19 TraesCS5D01G488400 chr1B 83.733 1125 141 24 1338 2456 579001936 579000848 0.000000e+00 1026.0
20 TraesCS5D01G488400 chr1B 82.812 1024 147 20 822 1827 577829416 577828404 0.000000e+00 889.0
21 TraesCS5D01G488400 chr6D 93.103 58 4 0 4 61 439602434 439602377 5.850000e-13 86.1
22 TraesCS5D01G488400 chr4B 89.655 58 6 0 4 61 437109415 437109358 1.270000e-09 75.0
23 TraesCS5D01G488400 chr4B 100.000 33 0 0 27 59 135038062 135038094 9.860000e-06 62.1
24 TraesCS5D01G488400 chr7B 85.185 54 8 0 3 56 50983135 50983188 4.590000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G488400 chr5D 523312433 523315724 3291 True 6080 6080 100.000000 1 3292 1 chr5D.!!$R4 3291
1 TraesCS5D01G488400 chr5D 523185244 523188536 3292 True 5958 5958 99.333000 1 3292 1 chr5D.!!$R3 3291
2 TraesCS5D01G488400 chrUn 352764321 352765419 1098 False 1893 1893 97.731000 2192 3292 1 chrUn.!!$F2 1100
3 TraesCS5D01G488400 chrUn 199129963 199133390 3427 False 1410 1910 98.704333 1 3292 3 chrUn.!!$F3 3291
4 TraesCS5D01G488400 chrUn 319376734 319377329 595 False 1062 1062 98.826000 1 596 1 chrUn.!!$F1 595
5 TraesCS5D01G488400 chr1A 522534443 522536008 1565 True 1507 1507 84.178000 873 2456 1 chr1A.!!$R3 1583
6 TraesCS5D01G488400 chr1A 522509299 522510878 1579 True 1334 1334 82.105000 938 2535 1 chr1A.!!$R1 1597
7 TraesCS5D01G488400 chr1A 522514959 522516518 1559 True 1245 1245 81.328000 770 2346 1 chr1A.!!$R2 1576
8 TraesCS5D01G488400 chr1D 427370841 427372342 1501 True 1485 1485 84.630000 941 2456 1 chr1D.!!$R3 1515
9 TraesCS5D01G488400 chr1D 427330719 427332212 1493 True 1410 1410 83.748000 987 2506 1 chr1D.!!$R2 1519
10 TraesCS5D01G488400 chr1D 427317958 427319645 1687 True 1330 1330 81.109000 822 2535 1 chr1D.!!$R1 1713
11 TraesCS5D01G488400 chr1D 427596038 427597443 1405 True 1044 1044 80.654000 446 1837 1 chr1D.!!$R4 1391
12 TraesCS5D01G488400 chr1B 577911649 577913101 1452 True 1474 1474 85.051000 999 2473 1 chr1B.!!$R2 1474
13 TraesCS5D01G488400 chr1B 578044005 578045553 1548 True 1371 1371 82.813000 838 2392 1 chr1B.!!$R3 1554
14 TraesCS5D01G488400 chr1B 579000848 579001936 1088 True 1026 1026 83.733000 1338 2456 1 chr1B.!!$R4 1118
15 TraesCS5D01G488400 chr1B 577828404 577829416 1012 True 889 889 82.812000 822 1827 1 chr1B.!!$R1 1005

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
437 438 1.666888 GGAAAAGCGACAACAGCCATG 60.667 52.381 0.00 0.00 34.64 3.66 F
1476 1859 0.179023 ACGGCCTTAACGTTTGGGAA 60.179 50.000 19.07 2.72 42.70 3.97 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1476 1859 1.547372 GCATTGTTCTGGTCAGCCATT 59.453 47.619 0.0 0.0 45.05 3.16 R
2406 3865 7.175293 ACCTCGCAAAAATTACAATAAGGTACA 59.825 33.333 0.0 0.0 31.86 2.90 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
437 438 1.666888 GGAAAAGCGACAACAGCCATG 60.667 52.381 0.00 0.00 34.64 3.66
1476 1859 0.179023 ACGGCCTTAACGTTTGGGAA 60.179 50.000 19.07 2.72 42.70 3.97
1797 3097 5.757099 TCCTGAAGGTAAACTCTTTAGGG 57.243 43.478 12.57 1.53 43.80 3.53
2406 3865 4.159879 GCCTAGTGTGGTGAATAGTGTACT 59.840 45.833 0.00 0.00 0.00 2.73
2407 3866 5.651530 CCTAGTGTGGTGAATAGTGTACTG 58.348 45.833 0.00 0.00 0.00 2.74
2542 4006 5.244755 TGCATAAACTACAATCAGCAGACA 58.755 37.500 0.00 0.00 0.00 3.41
2644 4108 1.291877 CCTGTTTCACCTCGGCTTCG 61.292 60.000 0.00 0.00 0.00 3.79
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
407 408 0.034896 TCGCTTTTCCCTGTCCACTC 59.965 55.000 0.00 0.0 0.00 3.51
706 718 5.347342 ACTCGTTCAAATCAAATGTTTGCA 58.653 33.333 0.66 0.0 38.05 4.08
1476 1859 1.547372 GCATTGTTCTGGTCAGCCATT 59.453 47.619 0.00 0.0 45.05 3.16
2406 3865 7.175293 ACCTCGCAAAAATTACAATAAGGTACA 59.825 33.333 0.00 0.0 31.86 2.90
2407 3866 7.483691 CACCTCGCAAAAATTACAATAAGGTAC 59.516 37.037 0.00 0.0 32.36 3.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.