Multiple sequence alignment - TraesCS5D01G488300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G488300 chr5D 100.000 3293 0 0 1 3293 523188535 523185243 0.000000e+00 6082.0
1 TraesCS5D01G488300 chr5D 99.333 3296 15 6 1 3293 523315723 523312432 0.000000e+00 5958.0
2 TraesCS5D01G488300 chr5D 94.817 328 17 0 2494 2821 522640261 522639934 2.270000e-141 512.0
3 TraesCS5D01G488300 chr5D 83.333 72 11 1 3 74 212007740 212007810 7.630000e-07 65.8
4 TraesCS5D01G488300 chr5D 86.441 59 8 0 3 61 315213066 315213008 7.630000e-07 65.8
5 TraesCS5D01G488300 chrUn 97.911 1101 22 1 2193 3293 199132292 199133391 0.000000e+00 1905.0
6 TraesCS5D01G488300 chrUn 97.639 1101 25 1 2193 3293 352764321 352765420 0.000000e+00 1888.0
7 TraesCS5D01G488300 chrUn 99.283 697 4 1 1495 2191 199131471 199132166 0.000000e+00 1258.0
8 TraesCS5D01G488300 chrUn 98.992 595 6 0 1 595 199129964 199130558 0.000000e+00 1066.0
9 TraesCS5D01G488300 chrUn 98.992 595 6 0 1 595 319376735 319377329 0.000000e+00 1066.0
10 TraesCS5D01G488300 chr1A 84.220 1597 208 28 873 2456 522536008 522534443 0.000000e+00 1513.0
11 TraesCS5D01G488300 chr1A 81.942 1617 236 39 938 2535 522510878 522509299 0.000000e+00 1317.0
12 TraesCS5D01G488300 chr1A 81.277 1597 243 35 770 2347 522516518 522514959 0.000000e+00 1242.0
13 TraesCS5D01G488300 chr1D 84.676 1527 198 22 941 2456 427372342 427370841 0.000000e+00 1491.0
14 TraesCS5D01G488300 chr1D 83.672 1525 213 31 987 2506 427332212 427330719 0.000000e+00 1404.0
15 TraesCS5D01G488300 chr1D 80.958 1733 266 46 822 2535 427319645 427317958 0.000000e+00 1314.0
16 TraesCS5D01G488300 chr1D 80.668 1438 201 46 445 1837 427597443 427596038 0.000000e+00 1044.0
17 TraesCS5D01G488300 chr1B 85.108 1484 181 21 999 2473 577913101 577911649 0.000000e+00 1480.0
18 TraesCS5D01G488300 chr1B 82.761 1572 233 28 838 2394 578045553 578044005 0.000000e+00 1367.0
19 TraesCS5D01G488300 chr1B 83.897 1124 141 23 1338 2456 579001936 579000848 0.000000e+00 1037.0
20 TraesCS5D01G488300 chr1B 83.250 997 141 17 822 1801 577829416 577828429 0.000000e+00 893.0
21 TraesCS5D01G488300 chr6D 93.103 58 4 0 3 60 439602434 439602377 5.850000e-13 86.1
22 TraesCS5D01G488300 chr4B 89.655 58 6 0 3 60 437109415 437109358 1.270000e-09 75.0
23 TraesCS5D01G488300 chr4B 100.000 33 0 0 26 58 135038062 135038094 9.870000e-06 62.1
24 TraesCS5D01G488300 chr7B 85.185 54 8 0 2 55 50983135 50983188 4.590000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G488300 chr5D 523185243 523188535 3292 True 6082.000000 6082 100.000000 1 3293 1 chr5D.!!$R3 3292
1 TraesCS5D01G488300 chr5D 523312432 523315723 3291 True 5958.000000 5958 99.333000 1 3293 1 chr5D.!!$R4 3292
2 TraesCS5D01G488300 chrUn 352764321 352765420 1099 False 1888.000000 1888 97.639000 2193 3293 1 chrUn.!!$F2 1100
3 TraesCS5D01G488300 chrUn 199129964 199133391 3427 False 1409.666667 1905 98.728667 1 3293 3 chrUn.!!$F3 3292
4 TraesCS5D01G488300 chrUn 319376735 319377329 594 False 1066.000000 1066 98.992000 1 595 1 chrUn.!!$F1 594
5 TraesCS5D01G488300 chr1A 522534443 522536008 1565 True 1513.000000 1513 84.220000 873 2456 1 chr1A.!!$R3 1583
6 TraesCS5D01G488300 chr1A 522509299 522510878 1579 True 1317.000000 1317 81.942000 938 2535 1 chr1A.!!$R1 1597
7 TraesCS5D01G488300 chr1A 522514959 522516518 1559 True 1242.000000 1242 81.277000 770 2347 1 chr1A.!!$R2 1577
8 TraesCS5D01G488300 chr1D 427370841 427372342 1501 True 1491.000000 1491 84.676000 941 2456 1 chr1D.!!$R3 1515
9 TraesCS5D01G488300 chr1D 427330719 427332212 1493 True 1404.000000 1404 83.672000 987 2506 1 chr1D.!!$R2 1519
10 TraesCS5D01G488300 chr1D 427317958 427319645 1687 True 1314.000000 1314 80.958000 822 2535 1 chr1D.!!$R1 1713
11 TraesCS5D01G488300 chr1D 427596038 427597443 1405 True 1044.000000 1044 80.668000 445 1837 1 chr1D.!!$R4 1392
12 TraesCS5D01G488300 chr1B 577911649 577913101 1452 True 1480.000000 1480 85.108000 999 2473 1 chr1B.!!$R2 1474
13 TraesCS5D01G488300 chr1B 578044005 578045553 1548 True 1367.000000 1367 82.761000 838 2394 1 chr1B.!!$R3 1556
14 TraesCS5D01G488300 chr1B 579000848 579001936 1088 True 1037.000000 1037 83.897000 1338 2456 1 chr1B.!!$R4 1118
15 TraesCS5D01G488300 chr1B 577828429 577829416 987 True 893.000000 893 83.250000 822 1801 1 chr1B.!!$R1 979

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
436 437 1.810151 GGAAAAGCGACAACAGCCATA 59.19 47.619 0.0 0.0 34.64 2.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2694 4158 4.986708 AAATTGGCCCGGTGCGGT 62.987 61.111 0.0 0.0 46.8 5.68 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
436 437 1.810151 GGAAAAGCGACAACAGCCATA 59.190 47.619 0.00 0.0 34.64 2.74
584 587 6.189677 TCATTAATTAGTTGTGGCCGAAAG 57.810 37.500 0.00 0.0 0.00 2.62
2542 4005 4.635765 TGCATAAACTACAATCAGCAGACC 59.364 41.667 0.00 0.0 0.00 3.85
2586 4049 9.128404 TGAGAATTACTCCTATAAAGAACGCTA 57.872 33.333 0.00 0.0 44.34 4.26
2643 4107 0.955919 CCTGTTTCACCTCGGCTTCC 60.956 60.000 0.00 0.0 0.00 3.46
3277 4741 2.590575 CCTTCACCCGCGTGTGTT 60.591 61.111 20.95 0.0 41.09 3.32
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
406 407 0.472471 TCGCTTTTCCCTGTCCACTT 59.528 50.000 0.00 0.00 0.00 3.16
702 713 3.451526 TCAAATCAAATGTTTGCGCACA 58.548 36.364 11.12 6.32 38.05 4.57
1213 1268 2.165301 GTACACGCATGAGTCGCCC 61.165 63.158 0.00 0.00 0.00 6.13
2694 4158 4.986708 AAATTGGCCCGGTGCGGT 62.987 61.111 0.00 0.00 46.80 5.68


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.