Multiple sequence alignment - TraesCS5D01G488200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G488200 chr5D 100.000 2192 0 0 1 2192 523038365 523036174 0.000000e+00 4048
1 TraesCS5D01G488200 chr5D 96.633 980 20 4 618 1594 503254360 503253391 0.000000e+00 1615
2 TraesCS5D01G488200 chr5D 97.213 610 13 3 1587 2192 503322347 503322956 0.000000e+00 1029
3 TraesCS5D01G488200 chr5D 96.053 608 20 4 1587 2192 432325208 432324603 0.000000e+00 987
4 TraesCS5D01G488200 chr5D 90.940 585 38 6 1 572 424172790 424172208 0.000000e+00 773
5 TraesCS5D01G488200 chr3D 97.347 980 22 3 618 1594 589249800 589248822 0.000000e+00 1663
6 TraesCS5D01G488200 chr3D 97.344 979 23 2 618 1594 158932456 158931479 0.000000e+00 1661
7 TraesCS5D01G488200 chr3D 97.242 979 23 3 620 1594 158938571 158937593 0.000000e+00 1655
8 TraesCS5D01G488200 chr3D 96.494 542 14 3 1654 2192 24156043 24156582 0.000000e+00 891
9 TraesCS5D01G488200 chr3D 97.352 491 11 2 1587 2075 545160353 545159863 0.000000e+00 833
10 TraesCS5D01G488200 chr5A 96.837 980 23 7 618 1594 482022428 482023402 0.000000e+00 1631
11 TraesCS5D01G488200 chr3B 96.636 981 23 7 618 1594 201553837 201554811 0.000000e+00 1620
12 TraesCS5D01G488200 chr3B 96.284 296 10 1 259 553 542736362 542736067 3.270000e-133 484
13 TraesCS5D01G488200 chr5B 95.214 982 33 8 618 1594 429064861 429063889 0.000000e+00 1541
14 TraesCS5D01G488200 chr5B 93.570 591 18 5 1 572 429065782 429065193 0.000000e+00 863
15 TraesCS5D01G488200 chr7B 93.986 981 47 6 618 1594 105212436 105211464 0.000000e+00 1474
16 TraesCS5D01G488200 chr7B 96.889 225 7 0 618 842 295520243 295520467 5.710000e-101 377
17 TraesCS5D01G488200 chr1D 94.942 949 34 9 618 1562 200552497 200551559 0.000000e+00 1474
18 TraesCS5D01G488200 chr1D 96.563 611 16 4 1587 2192 254468260 254468870 0.000000e+00 1007
19 TraesCS5D01G488200 chr1D 95.724 608 22 4 1587 2192 244192772 244193377 0.000000e+00 976
20 TraesCS5D01G488200 chr1D 93.643 582 19 8 1 572 200553074 200552501 0.000000e+00 854
21 TraesCS5D01G488200 chrUn 96.737 613 13 3 1587 2192 357609739 357609127 0.000000e+00 1014
22 TraesCS5D01G488200 chrUn 98.258 574 7 3 1 572 362350699 362351271 0.000000e+00 1002
23 TraesCS5D01G488200 chrUn 96.410 585 7 2 1 572 355920253 355920836 0.000000e+00 952
24 TraesCS5D01G488200 chrUn 93.543 604 6 10 1 572 341019025 341019627 0.000000e+00 869
25 TraesCS5D01G488200 chr2D 98.258 574 7 3 1 572 591995490 591996062 0.000000e+00 1002
26 TraesCS5D01G488200 chr4D 96.388 609 19 3 1587 2192 19909529 19910137 0.000000e+00 1000
27 TraesCS5D01G488200 chr4A 95.230 608 23 5 1587 2191 309401774 309401170 0.000000e+00 957
28 TraesCS5D01G488200 chr4A 94.234 607 32 3 1587 2192 205020544 205019940 0.000000e+00 924
29 TraesCS5D01G488200 chr4A 93.607 438 24 4 1 436 219292438 219292873 0.000000e+00 651
30 TraesCS5D01G488200 chr4A 95.930 172 4 1 1416 1584 726893720 726893549 2.140000e-70 276
31 TraesCS5D01G488200 chr6D 93.460 581 27 5 1 572 431006341 431005763 0.000000e+00 852
32 TraesCS5D01G488200 chr1A 93.426 578 29 5 1 572 371942313 371941739 0.000000e+00 848


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G488200 chr5D 523036174 523038365 2191 True 4048 4048 100.0000 1 2192 1 chr5D.!!$R4 2191
1 TraesCS5D01G488200 chr5D 503253391 503254360 969 True 1615 1615 96.6330 618 1594 1 chr5D.!!$R3 976
2 TraesCS5D01G488200 chr5D 503322347 503322956 609 False 1029 1029 97.2130 1587 2192 1 chr5D.!!$F1 605
3 TraesCS5D01G488200 chr5D 432324603 432325208 605 True 987 987 96.0530 1587 2192 1 chr5D.!!$R2 605
4 TraesCS5D01G488200 chr5D 424172208 424172790 582 True 773 773 90.9400 1 572 1 chr5D.!!$R1 571
5 TraesCS5D01G488200 chr3D 589248822 589249800 978 True 1663 1663 97.3470 618 1594 1 chr3D.!!$R4 976
6 TraesCS5D01G488200 chr3D 158931479 158932456 977 True 1661 1661 97.3440 618 1594 1 chr3D.!!$R1 976
7 TraesCS5D01G488200 chr3D 158937593 158938571 978 True 1655 1655 97.2420 620 1594 1 chr3D.!!$R2 974
8 TraesCS5D01G488200 chr3D 24156043 24156582 539 False 891 891 96.4940 1654 2192 1 chr3D.!!$F1 538
9 TraesCS5D01G488200 chr5A 482022428 482023402 974 False 1631 1631 96.8370 618 1594 1 chr5A.!!$F1 976
10 TraesCS5D01G488200 chr3B 201553837 201554811 974 False 1620 1620 96.6360 618 1594 1 chr3B.!!$F1 976
11 TraesCS5D01G488200 chr5B 429063889 429065782 1893 True 1202 1541 94.3920 1 1594 2 chr5B.!!$R1 1593
12 TraesCS5D01G488200 chr7B 105211464 105212436 972 True 1474 1474 93.9860 618 1594 1 chr7B.!!$R1 976
13 TraesCS5D01G488200 chr1D 200551559 200553074 1515 True 1164 1474 94.2925 1 1562 2 chr1D.!!$R1 1561
14 TraesCS5D01G488200 chr1D 254468260 254468870 610 False 1007 1007 96.5630 1587 2192 1 chr1D.!!$F2 605
15 TraesCS5D01G488200 chr1D 244192772 244193377 605 False 976 976 95.7240 1587 2192 1 chr1D.!!$F1 605
16 TraesCS5D01G488200 chrUn 357609127 357609739 612 True 1014 1014 96.7370 1587 2192 1 chrUn.!!$R1 605
17 TraesCS5D01G488200 chrUn 362350699 362351271 572 False 1002 1002 98.2580 1 572 1 chrUn.!!$F3 571
18 TraesCS5D01G488200 chrUn 355920253 355920836 583 False 952 952 96.4100 1 572 1 chrUn.!!$F2 571
19 TraesCS5D01G488200 chrUn 341019025 341019627 602 False 869 869 93.5430 1 572 1 chrUn.!!$F1 571
20 TraesCS5D01G488200 chr2D 591995490 591996062 572 False 1002 1002 98.2580 1 572 1 chr2D.!!$F1 571
21 TraesCS5D01G488200 chr4D 19909529 19910137 608 False 1000 1000 96.3880 1587 2192 1 chr4D.!!$F1 605
22 TraesCS5D01G488200 chr4A 309401170 309401774 604 True 957 957 95.2300 1587 2191 1 chr4A.!!$R2 604
23 TraesCS5D01G488200 chr4A 205019940 205020544 604 True 924 924 94.2340 1587 2192 1 chr4A.!!$R1 605
24 TraesCS5D01G488200 chr6D 431005763 431006341 578 True 852 852 93.4600 1 572 1 chr6D.!!$R1 571
25 TraesCS5D01G488200 chr1A 371941739 371942313 574 True 848 848 93.4260 1 572 1 chr1A.!!$R1 571

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
693 1076 6.787957 CCCGTCTTATCTTATATGGGGGATAT 59.212 42.308 0.0 0.0 34.94 1.63 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1817 2220 2.745152 GCAATGTCCGTTAGGCACCTAT 60.745 50.0 0.0 0.0 37.47 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
583 638 9.807921 ATTCCTTTCCTTTATAGTCAAACAAGA 57.192 29.630 0.00 0.00 0.00 3.02
584 639 8.617290 TCCTTTCCTTTATAGTCAAACAAGAC 57.383 34.615 0.00 0.00 38.81 3.01
585 640 8.215050 TCCTTTCCTTTATAGTCAAACAAGACA 58.785 33.333 0.00 0.00 40.98 3.41
586 641 8.846211 CCTTTCCTTTATAGTCAAACAAGACAA 58.154 33.333 0.00 0.00 40.98 3.18
693 1076 6.787957 CCCGTCTTATCTTATATGGGGGATAT 59.212 42.308 0.00 0.00 34.94 1.63
695 1078 7.509318 CCGTCTTATCTTATATGGGGGATATGA 59.491 40.741 0.00 0.00 0.00 2.15
1009 1393 6.622833 AATTTCCTTTTTGAATGGCAGTTG 57.377 33.333 0.00 0.00 0.00 3.16
1359 1752 7.569639 TTTGTTTGGTATACTGTGTGCTAAA 57.430 32.000 2.25 0.88 0.00 1.85
1812 2215 5.844004 AGTGTTCGGGTCTATTATGACATC 58.156 41.667 0.00 0.00 38.61 3.06
1817 2220 6.724893 TCGGGTCTATTATGACATCAAGAA 57.275 37.500 0.00 0.00 38.61 2.52
1838 2241 0.676782 AGGTGCCTAACGGACATTGC 60.677 55.000 0.00 0.00 0.00 3.56
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
104 141 5.073311 TGGTTTGGTGAATCGAAAACAAA 57.927 34.783 9.61 7.59 38.22 2.83
111 150 6.884295 AGATAAGAATTGGTTTGGTGAATCGA 59.116 34.615 0.00 0.00 0.00 3.59
597 652 9.773717 ATGGTATATATGGGGGATAAATTACCT 57.226 33.333 0.00 0.00 0.00 3.08
602 657 9.533068 TCAGAATGGTATATATGGGGGATAAAT 57.467 33.333 0.00 0.00 36.16 1.40
603 658 8.941639 TCAGAATGGTATATATGGGGGATAAA 57.058 34.615 0.00 0.00 36.16 1.40
604 659 8.778059 GTTCAGAATGGTATATATGGGGGATAA 58.222 37.037 0.00 0.00 36.16 1.75
605 660 8.135586 AGTTCAGAATGGTATATATGGGGGATA 58.864 37.037 0.00 0.00 36.16 2.59
606 661 6.974247 AGTTCAGAATGGTATATATGGGGGAT 59.026 38.462 0.00 0.00 36.16 3.85
607 662 6.339220 AGTTCAGAATGGTATATATGGGGGA 58.661 40.000 0.00 0.00 36.16 4.81
608 663 6.642733 AGTTCAGAATGGTATATATGGGGG 57.357 41.667 0.00 0.00 36.16 5.40
835 1219 6.112734 TGTCTAATGCGGATAAGACAACAAT 58.887 36.000 1.73 0.00 43.90 2.71
941 1325 5.511234 AAGACATCTATTGCTGCAAATCC 57.489 39.130 20.06 4.91 0.00 3.01
1332 1724 5.358442 AGCACACAGTATACCAAACAAAACA 59.642 36.000 0.00 0.00 0.00 2.83
1812 2215 3.195661 GTCCGTTAGGCACCTATTCTTG 58.804 50.000 0.00 0.00 37.47 3.02
1817 2220 2.745152 GCAATGTCCGTTAGGCACCTAT 60.745 50.000 0.00 0.00 37.47 2.57
1918 2324 7.369434 AGATATAGATAGGAGCTTATGCCCTT 58.631 38.462 13.39 0.00 39.45 3.95


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.