Multiple sequence alignment - TraesCS5D01G485700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G485700 chr5D 100.000 2978 0 0 1 2978 520969030 520972007 0.000000e+00 5500
1 TraesCS5D01G485700 chr5D 81.204 681 120 8 1004 1680 504972467 504973143 2.610000e-150 542
2 TraesCS5D01G485700 chr1D 97.750 2978 56 4 1 2978 33551712 33554678 0.000000e+00 5118
3 TraesCS5D01G485700 chr1D 97.681 2975 65 3 4 2978 404223662 404220692 0.000000e+00 5108
4 TraesCS5D01G485700 chr3D 96.709 2978 54 13 1 2978 40533521 40536454 0.000000e+00 4916
5 TraesCS5D01G485700 chr3D 97.811 2193 44 4 788 2978 520168720 520170910 0.000000e+00 3781
6 TraesCS5D01G485700 chr3D 97.774 1752 34 1 1 1752 584733728 584735474 0.000000e+00 3014
7 TraesCS5D01G485700 chr3D 97.657 1195 27 1 1784 2978 584735477 584736670 0.000000e+00 2050
8 TraesCS5D01G485700 chr3D 97.426 777 19 1 1 777 520167851 520168626 0.000000e+00 1323
9 TraesCS5D01G485700 chr3A 80.573 1395 231 32 908 2290 608109951 608108585 0.000000e+00 1038
10 TraesCS5D01G485700 chr5A 85.641 780 106 5 908 1684 234457883 234457107 0.000000e+00 815
11 TraesCS5D01G485700 chr2A 83.780 783 123 4 907 1687 57921985 57921205 0.000000e+00 739
12 TraesCS5D01G485700 chrUn 98.196 388 6 1 1630 2017 480435609 480435995 0.000000e+00 676


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G485700 chr5D 520969030 520972007 2977 False 5500 5500 100.0000 1 2978 1 chr5D.!!$F2 2977
1 TraesCS5D01G485700 chr5D 504972467 504973143 676 False 542 542 81.2040 1004 1680 1 chr5D.!!$F1 676
2 TraesCS5D01G485700 chr1D 33551712 33554678 2966 False 5118 5118 97.7500 1 2978 1 chr1D.!!$F1 2977
3 TraesCS5D01G485700 chr1D 404220692 404223662 2970 True 5108 5108 97.6810 4 2978 1 chr1D.!!$R1 2974
4 TraesCS5D01G485700 chr3D 40533521 40536454 2933 False 4916 4916 96.7090 1 2978 1 chr3D.!!$F1 2977
5 TraesCS5D01G485700 chr3D 520167851 520170910 3059 False 2552 3781 97.6185 1 2978 2 chr3D.!!$F2 2977
6 TraesCS5D01G485700 chr3D 584733728 584736670 2942 False 2532 3014 97.7155 1 2978 2 chr3D.!!$F3 2977
7 TraesCS5D01G485700 chr3A 608108585 608109951 1366 True 1038 1038 80.5730 908 2290 1 chr3A.!!$R1 1382
8 TraesCS5D01G485700 chr5A 234457107 234457883 776 True 815 815 85.6410 908 1684 1 chr5A.!!$R1 776
9 TraesCS5D01G485700 chr2A 57921205 57921985 780 True 739 739 83.7800 907 1687 1 chr2A.!!$R1 780

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
252 253 2.204463 TCCAGCATCACTTCCCCAATA 58.796 47.619 0.0 0.0 0.0 1.90 F
1776 1864 1.354031 TCCCATGCCTGCTCTGTAAAA 59.646 47.619 0.0 0.0 0.0 1.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1902 1990 0.038744 CCTTCCCAATGTCAGTGGCT 59.961 55.000 13.99 0.00 34.56 4.75 R
2625 2715 4.097437 AGAACCTTTGCATGCAGACATATG 59.903 41.667 21.50 7.78 33.67 1.78 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
252 253 2.204463 TCCAGCATCACTTCCCCAATA 58.796 47.619 0.00 0.00 0.00 1.90
468 469 2.506438 GTTTCGCCCGACTCTCCG 60.506 66.667 0.00 0.00 0.00 4.63
728 729 3.058293 TGGCGACTCTTGTGCATTTTTAG 60.058 43.478 0.00 0.00 0.00 1.85
1501 1589 3.421844 GTTCTGGCACCTAGGACAAAAT 58.578 45.455 17.98 0.00 0.00 1.82
1674 1762 2.093711 GGTTGGTTGCCACTTGTTTCTT 60.094 45.455 0.00 0.00 30.78 2.52
1776 1864 1.354031 TCCCATGCCTGCTCTGTAAAA 59.646 47.619 0.00 0.00 0.00 1.52
1883 1971 2.540101 GTGATTTCGACCAGAATAGCCG 59.460 50.000 0.00 0.00 38.86 5.52
1902 1990 4.038763 AGCCGGAAGAACATGATAACGATA 59.961 41.667 5.05 0.00 0.00 2.92
2161 2249 1.153188 TGGCAATCGCACGGATGAT 60.153 52.632 0.00 0.00 41.24 2.45
2376 2466 3.004210 TGCGTTTATTTTTCTGCTGCAGA 59.996 39.130 27.35 27.35 38.87 4.26
2625 2715 1.566298 AATCCCAGGTGTCAGGCTCC 61.566 60.000 0.00 0.00 0.00 4.70
2695 2785 8.417273 TCATTATTATCTTCCGTCCTCACATA 57.583 34.615 0.00 0.00 0.00 2.29
2706 2796 6.645306 TCCGTCCTCACATATTACAATGAAA 58.355 36.000 0.00 0.00 0.00 2.69
2932 3023 0.682852 ATTGACCTTCCCAACGACGA 59.317 50.000 0.00 0.00 0.00 4.20
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
259 260 2.676121 CCAAATGGCAGCGTGGGA 60.676 61.111 6.08 0.00 0.00 4.37
288 289 5.180492 TGAACGTAATTAAAGGCCTGAACTG 59.820 40.000 5.69 0.00 0.00 3.16
468 469 2.615262 GATCGACGGTGGGAGCTGAC 62.615 65.000 0.00 0.00 0.00 3.51
728 729 8.574737 AGTAAAACGGACTGTGATCCTATATAC 58.425 37.037 0.00 0.00 36.52 1.47
1501 1589 7.320399 CAATAGTCTATGGTGCCATAATCGTA 58.680 38.462 11.57 3.17 38.30 3.43
1544 1632 7.882791 ACCAATTATATTGCGTGATATTCTCCA 59.117 33.333 0.00 0.00 0.00 3.86
1674 1762 7.378966 TGAAAAACACATGTTTACAAACCTGA 58.621 30.769 10.29 0.00 46.47 3.86
1776 1864 9.579932 AAGAATATCTGAAAAAGAGACAAAGGT 57.420 29.630 0.00 0.00 38.67 3.50
1883 1971 5.177696 GTGGCTATCGTTATCATGTTCTTCC 59.822 44.000 0.00 0.00 0.00 3.46
1902 1990 0.038744 CCTTCCCAATGTCAGTGGCT 59.961 55.000 13.99 0.00 34.56 4.75
1998 2086 9.717942 CATGGAAATCCCTTAATACAAAAACAA 57.282 29.630 0.00 0.00 35.38 2.83
2161 2249 0.824109 CCTGGACTGAATCGTGCCTA 59.176 55.000 0.00 0.00 0.00 3.93
2376 2466 0.987081 ATGGTCAGCTCATCCCTGCT 60.987 55.000 0.00 0.00 40.54 4.24
2625 2715 4.097437 AGAACCTTTGCATGCAGACATATG 59.903 41.667 21.50 7.78 33.67 1.78
2695 2785 8.558700 GTGGCAAAGTGAAAATTTCATTGTAAT 58.441 29.630 17.89 0.00 42.47 1.89
2706 2796 8.776470 CAAATGAATTAGTGGCAAAGTGAAAAT 58.224 29.630 0.00 0.00 0.00 1.82


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.