Multiple sequence alignment - TraesCS5D01G473400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G473400 chr5D 100.000 2185 0 0 1 2185 513640542 513638358 0 4036
1 TraesCS5D01G473400 chr5D 95.006 1602 52 7 1 1574 503286456 503288057 0 2490
2 TraesCS5D01G473400 chr5D 94.697 1603 51 13 1 1574 6181788 6180191 0 2459
3 TraesCS5D01G473400 chr5D 94.628 1601 56 10 1 1574 120799026 120800623 0 2453
4 TraesCS5D01G473400 chr5D 93.258 1602 80 7 1 1574 167071089 167072690 0 2335
5 TraesCS5D01G473400 chr5D 92.079 505 17 3 1093 1574 512416233 512415729 0 689
6 TraesCS5D01G473400 chr5D 91.865 504 19 2 1093 1574 512409296 512408793 0 684
7 TraesCS5D01G473400 chr1D 94.598 1592 66 15 1 1574 254416220 254417809 0 2446
8 TraesCS5D01G473400 chr1D 94.431 1598 59 8 4 1574 51878913 51877319 0 2431
9 TraesCS5D01G473400 chr1D 94.797 615 28 4 1574 2185 394155659 394156272 0 955
10 TraesCS5D01G473400 chr1D 93.740 623 32 5 1570 2185 41070359 41069737 0 928
11 TraesCS5D01G473400 chr1D 93.984 615 33 4 1574 2185 356055630 356056243 0 928
12 TraesCS5D01G473400 chr1D 93.994 616 30 7 1574 2185 297874026 297873414 0 926
13 TraesCS5D01G473400 chr2A 94.500 1600 58 9 1 1574 335831472 335829877 0 2440
14 TraesCS5D01G473400 chr2A 92.967 583 27 11 1006 1574 334595893 334595311 0 837
15 TraesCS5D01G473400 chr6D 94.320 1602 53 10 2 1574 45512407 45510815 0 2420
16 TraesCS5D01G473400 chr6D 93.831 616 33 5 1574 2185 67970112 67969498 0 922
17 TraesCS5D01G473400 chr5A 93.966 1591 77 12 1 1574 607200935 607199347 0 2388
18 TraesCS5D01G473400 chr4A 93.312 1600 73 12 1 1574 310731438 310729847 0 2331
19 TraesCS5D01G473400 chr3B 96.589 1378 41 5 1 1372 101919890 101918513 0 2279
20 TraesCS5D01G473400 chr1A 94.566 1417 54 17 179 1574 554457800 554459214 0 2169
21 TraesCS5D01G473400 chr7D 94.165 617 32 4 1572 2185 275833491 275834106 0 937
22 TraesCS5D01G473400 chr7D 94.146 615 32 4 1574 2185 544505778 544506391 0 933
23 TraesCS5D01G473400 chr3D 94.146 615 32 4 1574 2185 452575566 452574953 0 933
24 TraesCS5D01G473400 chr2D 93.994 616 30 6 1574 2185 201033047 201032435 0 926


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G473400 chr5D 513638358 513640542 2184 True 4036 4036 100.000 1 2185 1 chr5D.!!$R4 2184
1 TraesCS5D01G473400 chr5D 503286456 503288057 1601 False 2490 2490 95.006 1 1574 1 chr5D.!!$F3 1573
2 TraesCS5D01G473400 chr5D 6180191 6181788 1597 True 2459 2459 94.697 1 1574 1 chr5D.!!$R1 1573
3 TraesCS5D01G473400 chr5D 120799026 120800623 1597 False 2453 2453 94.628 1 1574 1 chr5D.!!$F1 1573
4 TraesCS5D01G473400 chr5D 167071089 167072690 1601 False 2335 2335 93.258 1 1574 1 chr5D.!!$F2 1573
5 TraesCS5D01G473400 chr5D 512415729 512416233 504 True 689 689 92.079 1093 1574 1 chr5D.!!$R3 481
6 TraesCS5D01G473400 chr5D 512408793 512409296 503 True 684 684 91.865 1093 1574 1 chr5D.!!$R2 481
7 TraesCS5D01G473400 chr1D 254416220 254417809 1589 False 2446 2446 94.598 1 1574 1 chr1D.!!$F1 1573
8 TraesCS5D01G473400 chr1D 51877319 51878913 1594 True 2431 2431 94.431 4 1574 1 chr1D.!!$R2 1570
9 TraesCS5D01G473400 chr1D 394155659 394156272 613 False 955 955 94.797 1574 2185 1 chr1D.!!$F3 611
10 TraesCS5D01G473400 chr1D 41069737 41070359 622 True 928 928 93.740 1570 2185 1 chr1D.!!$R1 615
11 TraesCS5D01G473400 chr1D 356055630 356056243 613 False 928 928 93.984 1574 2185 1 chr1D.!!$F2 611
12 TraesCS5D01G473400 chr1D 297873414 297874026 612 True 926 926 93.994 1574 2185 1 chr1D.!!$R3 611
13 TraesCS5D01G473400 chr2A 335829877 335831472 1595 True 2440 2440 94.500 1 1574 1 chr2A.!!$R2 1573
14 TraesCS5D01G473400 chr2A 334595311 334595893 582 True 837 837 92.967 1006 1574 1 chr2A.!!$R1 568
15 TraesCS5D01G473400 chr6D 45510815 45512407 1592 True 2420 2420 94.320 2 1574 1 chr6D.!!$R1 1572
16 TraesCS5D01G473400 chr6D 67969498 67970112 614 True 922 922 93.831 1574 2185 1 chr6D.!!$R2 611
17 TraesCS5D01G473400 chr5A 607199347 607200935 1588 True 2388 2388 93.966 1 1574 1 chr5A.!!$R1 1573
18 TraesCS5D01G473400 chr4A 310729847 310731438 1591 True 2331 2331 93.312 1 1574 1 chr4A.!!$R1 1573
19 TraesCS5D01G473400 chr3B 101918513 101919890 1377 True 2279 2279 96.589 1 1372 1 chr3B.!!$R1 1371
20 TraesCS5D01G473400 chr1A 554457800 554459214 1414 False 2169 2169 94.566 179 1574 1 chr1A.!!$F1 1395
21 TraesCS5D01G473400 chr7D 275833491 275834106 615 False 937 937 94.165 1572 2185 1 chr7D.!!$F1 613
22 TraesCS5D01G473400 chr7D 544505778 544506391 613 False 933 933 94.146 1574 2185 1 chr7D.!!$F2 611
23 TraesCS5D01G473400 chr3D 452574953 452575566 613 True 933 933 94.146 1574 2185 1 chr3D.!!$R1 611
24 TraesCS5D01G473400 chr2D 201032435 201033047 612 True 926 926 93.994 1574 2185 1 chr2D.!!$R1 611

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
138 139 0.103208 AACGGATGGCTCGAGATGAC 59.897 55.0 18.75 3.17 0.0 3.06 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2087 2161 0.753262 CCTCCCGATGAAAGGATCGT 59.247 55.0 0.0 0.0 43.07 3.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
138 139 0.103208 AACGGATGGCTCGAGATGAC 59.897 55.000 18.75 3.17 0.00 3.06
356 359 9.930693 ATAGAATTCTCGTACTTCTTCAACTTT 57.069 29.630 12.24 0.00 31.89 2.66
544 548 8.651391 TCTTTCATAAACTTTTGTCTCGTACA 57.349 30.769 0.00 0.00 35.88 2.90
771 775 7.043961 TCTCTTGCTAGTATTCTACACATGG 57.956 40.000 0.00 0.00 0.00 3.66
901 908 6.407639 GGAGGTATTTTGTGTTTGGGAAAGTT 60.408 38.462 0.00 0.00 0.00 2.66
1091 1102 3.548014 CCAAATTACCCGAAGCTTATGCG 60.548 47.826 0.00 0.00 45.42 4.73
1219 1231 9.056005 GTACTCTGTATGCCAAATTGAATGATA 57.944 33.333 0.00 0.00 0.00 2.15
1372 1388 1.630878 CTTTCTACTCCCCTGCACCTT 59.369 52.381 0.00 0.00 0.00 3.50
1447 1504 9.669353 AGTGCTTATTATAAATGAATTCTTGCG 57.331 29.630 7.05 0.00 0.00 4.85
1542 1605 8.809468 AGGAAAAACTGGTAATCTATTCCTTC 57.191 34.615 0.00 0.00 41.91 3.46
1606 1671 7.874016 TCCATTTTGCATCATGCTTTTATATCC 59.126 33.333 11.84 0.00 45.31 2.59
1703 1768 9.853177 CAAGGTTTATATAAAGAGGGAGAATGT 57.147 33.333 8.18 0.00 0.00 2.71
1773 1838 3.281727 TCTGCACAACTCCAAAAGTCT 57.718 42.857 0.00 0.00 37.17 3.24
2044 2118 0.034670 GAGCTGTTCTGCCAGGGAAT 60.035 55.000 0.00 0.00 32.92 3.01
2087 2161 1.671556 CGTCACCATCGTCATCACCAA 60.672 52.381 0.00 0.00 0.00 3.67
2095 2169 1.548719 TCGTCATCACCAACGATCCTT 59.451 47.619 0.00 0.00 42.49 3.36
2145 2221 0.393537 CTTCACCAGCACCATCTCCC 60.394 60.000 0.00 0.00 0.00 4.30
2146 2222 2.124983 CACCAGCACCATCTCCCG 60.125 66.667 0.00 0.00 0.00 5.14
2172 2248 8.475639 GTCAAACCCTAGTTCATCTCTTGTATA 58.524 37.037 0.00 0.00 34.19 1.47
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
138 139 5.642919 CCTTCTCTTCTCACTTCAAGATTGG 59.357 44.000 0.00 0.0 0.00 3.16
524 528 9.953825 GTATTCTGTACGAGACAAAAGTTTATG 57.046 33.333 0.00 0.0 37.70 1.90
556 560 6.869315 TCTGATGAAACAAACGGTGAAATA 57.131 33.333 0.00 0.0 0.00 1.40
621 625 1.616159 GTAAGGCAGCAGGTTTTGGA 58.384 50.000 0.00 0.0 0.00 3.53
915 923 5.459536 AAGAAGGAAAAGGCAGATTCAAC 57.540 39.130 0.00 0.0 0.00 3.18
1150 1162 1.113788 AGCAGCTTGCCAAACAAAGA 58.886 45.000 0.00 0.0 46.52 2.52
1372 1388 1.353022 CTTTAGGTACCTGCCCAACCA 59.647 52.381 25.33 0.0 35.64 3.67
1542 1605 9.241317 GCATTACATAATCTCCAAGATGTTTTG 57.759 33.333 0.00 0.0 34.65 2.44
1686 1751 3.964688 TGCCGACATTCTCCCTCTTTATA 59.035 43.478 0.00 0.0 0.00 0.98
1689 1754 0.984230 TGCCGACATTCTCCCTCTTT 59.016 50.000 0.00 0.0 0.00 2.52
1703 1768 1.078214 CCAGAATTCCAGCTGCCGA 60.078 57.895 8.66 0.0 0.00 5.54
1773 1838 3.869065 ACTGACTTTCGTGGAGTTTCAA 58.131 40.909 0.00 0.0 0.00 2.69
2004 2078 1.447643 CCGGAGCCCTAGATTGGTG 59.552 63.158 0.00 0.0 0.00 4.17
2087 2161 0.753262 CCTCCCGATGAAAGGATCGT 59.247 55.000 0.00 0.0 43.07 3.73
2095 2169 0.837272 GATTGACCCCTCCCGATGAA 59.163 55.000 0.00 0.0 0.00 2.57
2145 2221 4.457834 AGAGATGAACTAGGGTTTGACG 57.542 45.455 0.00 0.0 35.58 4.35
2146 2222 5.552178 ACAAGAGATGAACTAGGGTTTGAC 58.448 41.667 0.00 0.0 35.58 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.