Multiple sequence alignment - TraesCS5D01G472900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G472900 chr5D 100.000 2792 0 0 1 2792 513380998 513383789 0.000000e+00 5156.0
1 TraesCS5D01G472900 chr5D 98.135 2038 37 1 755 2792 431826702 431828738 0.000000e+00 3552.0
2 TraesCS5D01G472900 chr5D 96.846 761 19 2 1 756 30552725 30553485 0.000000e+00 1267.0
3 TraesCS5D01G472900 chr5D 83.389 891 81 30 978 1844 558584945 558584098 0.000000e+00 763.0
4 TraesCS5D01G472900 chr5D 86.414 633 60 18 1885 2500 558584267 558583644 0.000000e+00 669.0
5 TraesCS5D01G472900 chr5D 77.947 984 124 48 756 1702 558614592 558615519 1.900000e-146 529.0
6 TraesCS5D01G472900 chr5D 87.008 254 19 7 1781 2023 431827647 431827897 9.850000e-70 274.0
7 TraesCS5D01G472900 chr5D 87.654 243 15 8 1711 1950 431827740 431827970 4.580000e-68 268.0
8 TraesCS5D01G472900 chr5D 86.614 254 20 7 1781 2023 513382697 513382947 4.580000e-68 268.0
9 TraesCS5D01G472900 chr5D 86.614 254 20 7 1700 1950 513382778 513383020 4.580000e-68 268.0
10 TraesCS5D01G472900 chr5D 85.507 138 18 2 1851 1986 558584235 558584098 2.900000e-30 143.0
11 TraesCS5D01G472900 chr5D 100.000 30 0 0 2596 2625 464690698 464690727 3.880000e-04 56.5
12 TraesCS5D01G472900 chr5B 94.398 1803 75 8 756 2550 524452429 524450645 0.000000e+00 2747.0
13 TraesCS5D01G472900 chr5B 92.999 757 49 4 3 756 120039280 120040035 0.000000e+00 1101.0
14 TraesCS5D01G472900 chr5B 79.800 1099 134 50 756 1813 524554294 524553243 0.000000e+00 719.0
15 TraesCS5D01G472900 chr5B 97.423 194 5 0 2599 2792 524450637 524450444 5.760000e-87 331.0
16 TraesCS5D01G472900 chr5B 88.327 257 18 6 1781 2026 524451496 524451241 5.850000e-77 298.0
17 TraesCS5D01G472900 chr5B 86.381 257 23 6 1700 1953 524451415 524451168 1.270000e-68 270.0
18 TraesCS5D01G472900 chr5B 100.000 30 0 0 2595 2624 206474748 206474719 3.880000e-04 56.5
19 TraesCS5D01G472900 chr5B 94.444 36 2 0 2596 2631 571616755 571616720 3.880000e-04 56.5
20 TraesCS5D01G472900 chr4D 97.086 755 21 1 3 756 426791348 426790594 0.000000e+00 1271.0
21 TraesCS5D01G472900 chr5A 93.923 757 42 4 3 756 599400743 599401498 0.000000e+00 1140.0
22 TraesCS5D01G472900 chr1A 93.536 758 44 5 3 757 6346583 6347338 0.000000e+00 1123.0
23 TraesCS5D01G472900 chr1A 90.244 41 3 1 2584 2623 484329350 484329390 5.000000e-03 52.8
24 TraesCS5D01G472900 chr4A 93.263 757 47 4 3 756 37977461 37978216 0.000000e+00 1112.0
25 TraesCS5D01G472900 chr4A 81.595 489 61 19 858 1332 611918542 611919015 7.300000e-101 377.0
26 TraesCS5D01G472900 chr4A 100.000 31 0 0 2527 2557 36532628 36532658 1.080000e-04 58.4
27 TraesCS5D01G472900 chr3A 93.263 757 47 4 3 756 626674837 626674082 0.000000e+00 1112.0
28 TraesCS5D01G472900 chr7B 93.131 757 48 4 3 756 297419344 297420099 0.000000e+00 1107.0
29 TraesCS5D01G472900 chr1B 93.122 756 50 2 3 756 272868263 272867508 0.000000e+00 1107.0
30 TraesCS5D01G472900 chr1B 84.375 224 17 10 906 1115 683240360 683240579 1.310000e-48 204.0
31 TraesCS5D01G472900 chr1B 78.039 255 27 12 815 1056 683310727 683310965 1.740000e-27 134.0
32 TraesCS5D01G472900 chrUn 91.139 237 13 1 756 992 478696070 478695842 5.810000e-82 315.0
33 TraesCS5D01G472900 chr7D 100.000 30 0 0 2595 2624 528895834 528895805 3.880000e-04 56.5
34 TraesCS5D01G472900 chr3D 100.000 30 0 0 2595 2624 49216570 49216599 3.880000e-04 56.5
35 TraesCS5D01G472900 chr3D 100.000 30 0 0 2595 2624 101660533 101660504 3.880000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G472900 chr5D 513380998 513383789 2791 False 1897.333333 5156 91.076000 1 2792 3 chr5D.!!$F5 2791
1 TraesCS5D01G472900 chr5D 431826702 431828738 2036 False 1364.666667 3552 90.932333 755 2792 3 chr5D.!!$F4 2037
2 TraesCS5D01G472900 chr5D 30552725 30553485 760 False 1267.000000 1267 96.846000 1 756 1 chr5D.!!$F1 755
3 TraesCS5D01G472900 chr5D 558614592 558615519 927 False 529.000000 529 77.947000 756 1702 1 chr5D.!!$F3 946
4 TraesCS5D01G472900 chr5D 558583644 558584945 1301 True 525.000000 763 85.103333 978 2500 3 chr5D.!!$R1 1522
5 TraesCS5D01G472900 chr5B 120039280 120040035 755 False 1101.000000 1101 92.999000 3 756 1 chr5B.!!$F1 753
6 TraesCS5D01G472900 chr5B 524450444 524452429 1985 True 911.500000 2747 91.632250 756 2792 4 chr5B.!!$R4 2036
7 TraesCS5D01G472900 chr5B 524553243 524554294 1051 True 719.000000 719 79.800000 756 1813 1 chr5B.!!$R2 1057
8 TraesCS5D01G472900 chr4D 426790594 426791348 754 True 1271.000000 1271 97.086000 3 756 1 chr4D.!!$R1 753
9 TraesCS5D01G472900 chr5A 599400743 599401498 755 False 1140.000000 1140 93.923000 3 756 1 chr5A.!!$F1 753
10 TraesCS5D01G472900 chr1A 6346583 6347338 755 False 1123.000000 1123 93.536000 3 757 1 chr1A.!!$F1 754
11 TraesCS5D01G472900 chr4A 37977461 37978216 755 False 1112.000000 1112 93.263000 3 756 1 chr4A.!!$F2 753
12 TraesCS5D01G472900 chr3A 626674082 626674837 755 True 1112.000000 1112 93.263000 3 756 1 chr3A.!!$R1 753
13 TraesCS5D01G472900 chr7B 297419344 297420099 755 False 1107.000000 1107 93.131000 3 756 1 chr7B.!!$F1 753
14 TraesCS5D01G472900 chr1B 272867508 272868263 755 True 1107.000000 1107 93.122000 3 756 1 chr1B.!!$R1 753

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
934 941 0.39382 TAGTTCCGACCCGCAAGTTT 59.606 50.0 0.0 0.0 0.0 2.66 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2512 2611 1.201921 GCACTAACCATTTGAGCGACG 60.202 52.381 0.0 0.0 0.0 5.12 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
222 227 1.206878 AGGACCTGCATGTATCAGCA 58.793 50.000 0.00 0.00 39.25 4.41
331 336 1.271840 ATCTGGTAGAAGGGGCGCAA 61.272 55.000 10.83 0.00 0.00 4.85
531 536 2.088104 TGATAGGCTCGGATGTTCCT 57.912 50.000 0.00 0.00 33.30 3.36
692 699 2.617788 CCACCTGTGGCTTGCTAATACA 60.618 50.000 2.89 0.00 44.73 2.29
696 703 1.352687 TGTGGCTTGCTAATACACCCA 59.647 47.619 0.00 0.00 0.00 4.51
706 713 5.368145 TGCTAATACACCCAACATCATCTC 58.632 41.667 0.00 0.00 0.00 2.75
710 717 8.531982 GCTAATACACCCAACATCATCTCTATA 58.468 37.037 0.00 0.00 0.00 1.31
804 811 0.620556 ACTGCCCGATCCATCAAAGT 59.379 50.000 0.00 0.00 0.00 2.66
877 884 3.798515 ACCCTAACAACCAGTAGATCCA 58.201 45.455 0.00 0.00 0.00 3.41
934 941 0.393820 TAGTTCCGACCCGCAAGTTT 59.606 50.000 0.00 0.00 0.00 2.66
1258 1283 8.761575 TCCTTAAAACATGCATCTTTTTCATC 57.238 30.769 16.35 0.00 0.00 2.92
1353 1413 6.620877 TTCCATTAAAAGAGACTGCCTAGA 57.379 37.500 0.00 0.00 0.00 2.43
1509 1577 2.548920 GCAATCTAGATCCACCCCTTCG 60.549 54.545 5.51 0.00 0.00 3.79
1544 1624 0.098376 GCGCAAATCCAGCAGAAGAG 59.902 55.000 0.30 0.00 0.00 2.85
1877 1963 2.076863 CCCTGTTTTTCCTCTGCTACG 58.923 52.381 0.00 0.00 0.00 3.51
2079 2173 1.721664 CTACGTACCTGCAGGCGCTA 61.722 60.000 33.06 15.14 39.64 4.26
2174 2268 3.453717 TCCTGACTTAGCTACTCGTCCTA 59.546 47.826 12.10 0.00 0.00 2.94
2221 2315 6.604795 AGATGAAAGGTATCTTGTTTGATGGG 59.395 38.462 0.00 0.00 30.98 4.00
2306 2405 7.288621 ACATGACTATGATCTGTCACCTATGAA 59.711 37.037 15.23 0.00 44.52 2.57
2512 2611 8.112016 AGATTTCTTTCTTTAGTTGTAAGCCC 57.888 34.615 0.00 0.00 0.00 5.19
2552 2651 6.701340 AGTGCTAGATACATCTGTTTGAACA 58.299 36.000 1.88 0.00 37.76 3.18
2568 2667 7.155328 TGTTTGAACAACAAGCTTTTTAGGAA 58.845 30.769 0.00 0.00 39.76 3.36
2578 2677 9.755122 AACAAGCTTTTTAGGAAGGAGTATTAT 57.245 29.630 0.00 0.00 0.00 1.28
2724 2823 5.869753 ATGAGTCAATATCTATTTGGCGC 57.130 39.130 0.00 0.00 0.00 6.53
2769 2868 1.702957 TGGACTTGGGGAACTTGTAGG 59.297 52.381 0.00 0.00 0.00 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
222 227 2.371306 GCTCTAGTCCTCGAGTTTCCT 58.629 52.381 12.31 3.84 0.00 3.36
331 336 3.550431 ACGGCAGACCACAGCTGT 61.550 61.111 15.25 15.25 41.95 4.40
531 536 1.040339 AAACCGAGGCAAACTGGCAA 61.040 50.000 2.87 0.00 46.46 4.52
608 615 4.037690 GCGCTTCGAAATTATGCTTCATT 58.962 39.130 0.00 0.00 0.00 2.57
610 617 2.418280 TGCGCTTCGAAATTATGCTTCA 59.582 40.909 9.73 0.00 0.00 3.02
646 653 2.504367 CGGGAGACAAAGAAACCACAT 58.496 47.619 0.00 0.00 0.00 3.21
692 699 7.248976 TCATAGGTATAGAGATGATGTTGGGT 58.751 38.462 0.00 0.00 0.00 4.51
804 811 2.530701 GAGGAGGAGAAGAAGGACACA 58.469 52.381 0.00 0.00 0.00 3.72
1001 1012 3.797353 GGAGGGAAGCCGCCATCA 61.797 66.667 9.01 0.00 40.39 3.07
1024 1035 3.518998 CAGGATCCTCGTCGCCGT 61.519 66.667 12.69 0.00 35.01 5.68
1120 1134 4.103311 GTGAGGCCATAGGTCTAGGAAAAT 59.897 45.833 5.01 0.00 38.01 1.82
1278 1303 1.204231 TCAAGCAGCACAGCAAAACAA 59.796 42.857 0.00 0.00 36.85 2.83
1509 1577 3.050275 GCTGCACGGTCCTCCAAC 61.050 66.667 0.00 0.00 0.00 3.77
1544 1624 2.603021 TGAGATCATACAGCTCCTCCC 58.397 52.381 0.00 0.00 0.00 4.30
1707 1791 2.038557 TCCTGTAGCAGAGGGAAAACAC 59.961 50.000 0.00 0.00 32.44 3.32
1877 1963 9.269453 GATATTGTACCATTAAGGGTAACTCAC 57.731 37.037 20.01 10.93 44.66 3.51
2079 2173 4.777896 TCACCTTCTTGGCTGTAGTTATCT 59.222 41.667 0.00 0.00 40.22 1.98
2174 2268 7.288810 TCTTTCACTTCATTGGCTTGTATTT 57.711 32.000 0.00 0.00 0.00 1.40
2221 2315 7.877097 AGAACTGATATACATCATCTTGCTTCC 59.123 37.037 0.00 0.00 40.40 3.46
2512 2611 1.201921 GCACTAACCATTTGAGCGACG 60.202 52.381 0.00 0.00 0.00 5.12
2552 2651 9.755122 ATAATACTCCTTCCTAAAAAGCTTGTT 57.245 29.630 7.15 7.15 0.00 2.83
2568 2667 8.256356 AGATTGAGCACAAGTATAATACTCCT 57.744 34.615 2.37 0.00 38.26 3.69
2724 2823 4.006989 TCAACCATTGTTAAGGATCACCG 58.993 43.478 0.00 0.00 35.63 4.94


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.