Multiple sequence alignment - TraesCS5D01G472800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G472800 chr5D 100.000 3100 0 0 1 3100 513348156 513351255 0.000000e+00 5725
1 TraesCS5D01G472800 chr5D 97.299 3110 36 6 1 3100 431811583 431814654 0.000000e+00 5234
2 TraesCS5D01G472800 chr5D 96.657 3111 43 15 1 3100 433652218 433649158 0.000000e+00 5112
3 TraesCS5D01G472800 chr5D 78.922 408 70 9 1591 1985 431889387 431889791 2.370000e-66 263
4 TraesCS5D01G472800 chr5D 78.624 407 68 12 1594 1985 433515682 433515280 5.130000e-63 252
5 TraesCS5D01G472800 chr5D 77.660 376 59 12 1623 1985 513288815 513288452 4.050000e-49 206
6 TraesCS5D01G472800 chr5B 94.124 953 39 6 1277 2213 522791521 522790570 0.000000e+00 1434
7 TraesCS5D01G472800 chr5B 96.224 821 19 5 2289 3100 522786581 522785764 0.000000e+00 1334
8 TraesCS5D01G472800 chr5B 96.102 821 20 5 2289 3100 522723667 522722850 0.000000e+00 1328
9 TraesCS5D01G472800 chr5B 95.785 783 20 6 2289 3062 522678327 522677549 0.000000e+00 1251
10 TraesCS5D01G472800 chr5B 94.293 771 34 2 1 761 522815050 522814280 0.000000e+00 1171
11 TraesCS5D01G472800 chr5B 94.526 475 23 2 753 1227 522792259 522791788 0.000000e+00 730
12 TraesCS5D01G472800 chr5B 77.522 565 86 23 1032 1558 522597816 522597255 5.020000e-78 302
13 TraesCS5D01G472800 chr5B 79.259 405 68 9 1594 1985 522622939 522622538 5.100000e-68 268
14 TraesCS5D01G472800 chr5B 76.471 425 62 20 1594 1985 522927459 522927878 2.440000e-46 196
15 TraesCS5D01G472800 chr5B 89.011 91 1 1 2211 2292 522678438 522678348 1.520000e-18 104
16 TraesCS5D01G472800 chr5B 89.011 91 1 1 2211 2292 522723778 522723688 1.520000e-18 104
17 TraesCS5D01G472800 chr5B 89.011 91 1 1 2211 2292 522786692 522786602 1.520000e-18 104
18 TraesCS5D01G472800 chr5A 95.823 814 21 6 2296 3099 547001555 547002365 0.000000e+00 1303
19 TraesCS5D01G472800 chr5A 93.478 828 29 4 1489 2292 546998798 546999624 0.000000e+00 1206
20 TraesCS5D01G472800 chr5A 87.081 805 65 12 696 1489 546997034 546997810 0.000000e+00 874
21 TraesCS5D01G472800 chr5A 77.866 253 41 11 936 1179 547023099 547023345 3.220000e-30 143


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G472800 chr5D 513348156 513351255 3099 False 5725.000000 5725 100.000000 1 3100 1 chr5D.!!$F3 3099
1 TraesCS5D01G472800 chr5D 431811583 431814654 3071 False 5234.000000 5234 97.299000 1 3100 1 chr5D.!!$F1 3099
2 TraesCS5D01G472800 chr5D 433649158 433652218 3060 True 5112.000000 5112 96.657000 1 3100 1 chr5D.!!$R2 3099
3 TraesCS5D01G472800 chr5B 522814280 522815050 770 True 1171.000000 1171 94.293000 1 761 1 chr5B.!!$R3 760
4 TraesCS5D01G472800 chr5B 522785764 522792259 6495 True 900.500000 1434 93.471250 753 3100 4 chr5B.!!$R6 2347
5 TraesCS5D01G472800 chr5B 522722850 522723778 928 True 716.000000 1328 92.556500 2211 3100 2 chr5B.!!$R5 889
6 TraesCS5D01G472800 chr5B 522677549 522678438 889 True 677.500000 1251 92.398000 2211 3062 2 chr5B.!!$R4 851
7 TraesCS5D01G472800 chr5B 522597255 522597816 561 True 302.000000 302 77.522000 1032 1558 1 chr5B.!!$R1 526
8 TraesCS5D01G472800 chr5A 546997034 547002365 5331 False 1127.666667 1303 92.127333 696 3099 3 chr5A.!!$F2 2403

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
418 428 1.024271 CTGTGTTCCAGTGTGGGTTG 58.976 55.000 0.0 0.0 38.32 3.77 F
565 576 2.289547 CGATTGGTGGTGTTTTCTCGTT 59.710 45.455 0.0 0.0 0.00 3.85 F
1691 2955 1.066858 CAATGGCGTCACCTACACTCT 60.067 52.381 0.0 0.0 40.22 3.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1257 1306 0.249363 GAAGGCCGATAGAACCGTCC 60.249 60.000 0.00 0.00 35.65 4.79 R
1867 3131 0.890683 TCGTCATGCAAGCTGAGAGA 59.109 50.000 0.00 0.00 0.00 3.10 R
2779 9876 3.119352 GGCTATGTTTTCTCCTTGGCAAG 60.119 47.826 20.31 20.31 0.00 4.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
216 226 3.132824 AGCATCAAGTACATGGTGATCGA 59.867 43.478 15.29 0.0 33.06 3.59
316 326 2.381911 AGGACGTCCGGCTTAAATAGA 58.618 47.619 28.26 0.0 42.08 1.98
391 401 2.017559 GAGGCGCCCGTCAGAATAGT 62.018 60.000 26.15 0.0 0.00 2.12
418 428 1.024271 CTGTGTTCCAGTGTGGGTTG 58.976 55.000 0.00 0.0 38.32 3.77
565 576 2.289547 CGATTGGTGGTGTTTTCTCGTT 59.710 45.455 0.00 0.0 0.00 3.85
1535 2799 4.202295 GCTAGATGGTGATGATGAAGTCCA 60.202 45.833 0.00 0.0 0.00 4.02
1691 2955 1.066858 CAATGGCGTCACCTACACTCT 60.067 52.381 0.00 0.0 40.22 3.24
1867 3131 3.329889 TCCACGCAGGGCATCCTT 61.330 61.111 0.00 0.0 42.67 3.36
2779 9876 6.618287 TCATCGGTGGAATAATGAAATGTC 57.382 37.500 0.00 0.0 0.00 3.06
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
16 17 0.028770 CAAAGCAGTCGCCGAAAACA 59.971 50.000 0.00 0.00 39.83 2.83
189 199 3.373130 CACCATGTACTTGATGCTGACAG 59.627 47.826 10.20 0.00 0.00 3.51
216 226 0.603707 CACTTGCCATGTCGAGGTGT 60.604 55.000 0.00 0.00 0.00 4.16
387 397 3.248024 TGGAACACAGAGGAACCACTAT 58.752 45.455 0.00 0.00 0.00 2.12
418 428 2.460918 CCACGTCAGATTGACCGATAC 58.539 52.381 3.81 0.00 44.20 2.24
948 969 1.577922 GACGTAGACCAGCGTGTCA 59.422 57.895 10.63 0.00 41.70 3.58
1030 1051 3.650950 GGCCCAGAAGGTGAGGCA 61.651 66.667 1.88 0.00 41.77 4.75
1257 1306 0.249363 GAAGGCCGATAGAACCGTCC 60.249 60.000 0.00 0.00 35.65 4.79
1867 3131 0.890683 TCGTCATGCAAGCTGAGAGA 59.109 50.000 0.00 0.00 0.00 3.10
2683 9779 9.561069 TCCATGCTAACTTATTTTTCTATCTCC 57.439 33.333 0.00 0.00 0.00 3.71
2779 9876 3.119352 GGCTATGTTTTCTCCTTGGCAAG 60.119 47.826 20.31 20.31 0.00 4.01
2882 9983 5.105595 GCTCCTTTGAACCAATATGCTCTTT 60.106 40.000 0.00 0.00 0.00 2.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.