Multiple sequence alignment - TraesCS5D01G463200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G463200 chr5D 100.000 2530 0 0 1 2530 506740252 506737723 0.000000e+00 4673
1 TraesCS5D01G463200 chr5D 90.708 1851 149 16 701 2530 507518520 507516672 0.000000e+00 2444
2 TraesCS5D01G463200 chr5D 98.465 1303 20 0 1228 2530 506703339 506702037 0.000000e+00 2296
3 TraesCS5D01G463200 chr5D 96.291 728 25 2 1 728 506704292 506703567 0.000000e+00 1194
4 TraesCS5D01G463200 chr5D 91.575 724 52 9 7 728 507519238 507518522 0.000000e+00 990
5 TraesCS5D01G463200 chr5D 98.058 206 4 0 721 926 506703542 506703337 2.390000e-95 359
6 TraesCS5D01G463200 chr5B 93.022 2551 144 14 1 2530 637216494 637213957 0.000000e+00 3694
7 TraesCS5D01G463200 chr5B 87.247 1827 169 34 721 2530 637804420 637802641 0.000000e+00 2025
8 TraesCS5D01G463200 chr5B 86.961 1833 169 36 721 2530 637783254 637781469 0.000000e+00 1997
9 TraesCS5D01G463200 chr5B 87.584 1482 139 22 721 2186 637729254 637727802 0.000000e+00 1676
10 TraesCS5D01G463200 chr5B 91.269 733 53 8 1 728 637784005 637783279 0.000000e+00 989
11 TraesCS5D01G463200 chr5B 91.132 733 54 8 1 728 637805171 637804445 0.000000e+00 983
12 TraesCS5D01G463200 chr5A 93.377 1842 98 17 709 2530 634358133 634356296 0.000000e+00 2704
13 TraesCS5D01G463200 chr5A 90.500 1579 134 11 954 2528 635245644 635247210 0.000000e+00 2071
14 TraesCS5D01G463200 chr5A 89.690 1581 140 15 954 2530 634989962 634988401 0.000000e+00 1995
15 TraesCS5D01G463200 chr5A 88.495 1043 102 15 721 1754 638381528 638382561 0.000000e+00 1245
16 TraesCS5D01G463200 chr5A 92.995 728 50 1 1 728 634358869 634358143 0.000000e+00 1061
17 TraesCS5D01G463200 chr5A 89.222 733 60 13 1 728 634990964 634990246 0.000000e+00 898
18 TraesCS5D01G463200 chr5A 88.677 733 65 12 1 728 635244640 635245359 0.000000e+00 878
19 TraesCS5D01G463200 chr5A 89.296 682 71 2 48 728 638380823 638381503 0.000000e+00 854
20 TraesCS5D01G463200 chr5A 87.311 528 64 3 2006 2530 638334268 638333741 3.600000e-168 601


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G463200 chr5D 506737723 506740252 2529 True 4673.0 4673 100.000000 1 2530 1 chr5D.!!$R1 2529
1 TraesCS5D01G463200 chr5D 507516672 507519238 2566 True 1717.0 2444 91.141500 7 2530 2 chr5D.!!$R3 2523
2 TraesCS5D01G463200 chr5D 506702037 506704292 2255 True 1283.0 2296 97.604667 1 2530 3 chr5D.!!$R2 2529
3 TraesCS5D01G463200 chr5B 637213957 637216494 2537 True 3694.0 3694 93.022000 1 2530 1 chr5B.!!$R1 2529
4 TraesCS5D01G463200 chr5B 637727802 637729254 1452 True 1676.0 1676 87.584000 721 2186 1 chr5B.!!$R2 1465
5 TraesCS5D01G463200 chr5B 637802641 637805171 2530 True 1504.0 2025 89.189500 1 2530 2 chr5B.!!$R4 2529
6 TraesCS5D01G463200 chr5B 637781469 637784005 2536 True 1493.0 1997 89.115000 1 2530 2 chr5B.!!$R3 2529
7 TraesCS5D01G463200 chr5A 634356296 634358869 2573 True 1882.5 2704 93.186000 1 2530 2 chr5A.!!$R2 2529
8 TraesCS5D01G463200 chr5A 635244640 635247210 2570 False 1474.5 2071 89.588500 1 2528 2 chr5A.!!$F1 2527
9 TraesCS5D01G463200 chr5A 634988401 634990964 2563 True 1446.5 1995 89.456000 1 2530 2 chr5A.!!$R3 2529
10 TraesCS5D01G463200 chr5A 638380823 638382561 1738 False 1049.5 1245 88.895500 48 1754 2 chr5A.!!$F2 1706
11 TraesCS5D01G463200 chr5A 638333741 638334268 527 True 601.0 601 87.311000 2006 2530 1 chr5A.!!$R1 524

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
428 429 0.16747 CATCACCAAGCAGTCAAGCG 59.833 55.0 0.0 0.0 40.15 4.68 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2004 2091 2.816113 AGGAGGGAGGGATAAGTAGGA 58.184 52.381 0.0 0.0 0.0 2.94 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
110 111 0.394762 CCACCCACCCATCACTGATG 60.395 60.000 11.59 11.59 39.52 3.07
309 310 2.257409 ATTGGAGAGCGGTGCGGATT 62.257 55.000 0.00 0.00 0.00 3.01
350 351 0.822532 GAGATTGGCTGGCCATGAGG 60.823 60.000 15.41 0.00 46.64 3.86
373 374 3.474570 CTCCCCTTCGGCCCTCTG 61.475 72.222 0.00 0.00 0.00 3.35
428 429 0.167470 CATCACCAAGCAGTCAAGCG 59.833 55.000 0.00 0.00 40.15 4.68
518 522 7.857404 AAGTTCTAGCCTTAGCCTTCATATA 57.143 36.000 0.00 0.00 41.25 0.86
710 715 7.093684 TGCCTCTATATATACGTGTTGCCATTA 60.094 37.037 0.00 0.00 0.00 1.90
1097 1170 3.840468 TCTCGCAGAAGTTACGCAATTA 58.160 40.909 0.00 0.00 34.09 1.40
1152 1225 4.479786 AGAAGCAGTTGACCTATTCCTC 57.520 45.455 0.00 0.00 0.00 3.71
1153 1226 3.840666 AGAAGCAGTTGACCTATTCCTCA 59.159 43.478 0.00 0.00 0.00 3.86
1564 1639 4.380531 TCCTTGAGCGATGGATGAAATAC 58.619 43.478 0.00 0.00 0.00 1.89
1674 1749 7.311364 TGTTAAAGTTTGTTCGTTCTAAGCT 57.689 32.000 0.00 0.00 0.00 3.74
1675 1750 7.754625 TGTTAAAGTTTGTTCGTTCTAAGCTT 58.245 30.769 3.48 3.48 0.00 3.74
1756 1840 7.195646 CACCAATATAAATATGGCGCAATAGG 58.804 38.462 10.83 5.28 0.00 2.57
2072 2167 1.274167 TCTACATCGTCGTTGCCCTTT 59.726 47.619 3.21 0.00 0.00 3.11
2094 2190 2.175715 GTCCCATCAGCCTTCCCTAATT 59.824 50.000 0.00 0.00 0.00 1.40
2307 2415 3.997952 GCCTCCCCTTTGCCCCTT 61.998 66.667 0.00 0.00 0.00 3.95
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
110 111 2.743179 GGATCGGGGGTGAGTTCCC 61.743 68.421 0.00 0.00 46.31 3.97
113 114 1.344087 ACATAGGATCGGGGGTGAGTT 60.344 52.381 0.00 0.00 0.00 3.01
118 119 1.113517 CGACACATAGGATCGGGGGT 61.114 60.000 0.00 0.00 32.22 4.95
291 292 2.463589 AAATCCGCACCGCTCTCCAA 62.464 55.000 0.00 0.00 0.00 3.53
309 310 0.947960 TCGCCTTCACGATGCAAAAA 59.052 45.000 0.00 0.00 37.09 1.94
373 374 9.143631 GTACCCCGATTATGTTGTGTTATATAC 57.856 37.037 0.00 0.00 0.00 1.47
428 429 2.026822 TGGAGATCTTTCCACTCTTGCC 60.027 50.000 0.00 0.00 42.24 4.52
518 522 8.655935 ATTGAGAAACAAAGAATGGAATAGGT 57.344 30.769 0.00 0.00 42.03 3.08
710 715 9.762381 TGTAGGTCCAGAAAATAAACCATAAAT 57.238 29.630 0.00 0.00 32.25 1.40
989 1062 3.136009 TGGATGCCATGATCAGCTAAG 57.864 47.619 0.09 0.00 0.00 2.18
1066 1139 0.614697 TTCTGCGAGAGGACCATCCA 60.615 55.000 0.00 0.00 39.61 3.41
1097 1170 4.626042 GGCGAGAGTAATCTCACATTGAT 58.374 43.478 19.38 0.00 42.66 2.57
1152 1225 6.840780 ATAATGTCAAACTTCTTCCCCTTG 57.159 37.500 0.00 0.00 0.00 3.61
1153 1226 7.855784 AAATAATGTCAAACTTCTTCCCCTT 57.144 32.000 0.00 0.00 0.00 3.95
1564 1639 6.506500 AACATAGTTCCATGAGCAGAAAAG 57.493 37.500 0.00 0.00 0.00 2.27
1674 1749 4.160439 AGGATAGCGTCTCATGTTCTTCAA 59.840 41.667 0.00 0.00 0.00 2.69
1675 1750 3.701542 AGGATAGCGTCTCATGTTCTTCA 59.298 43.478 0.00 0.00 0.00 3.02
1756 1840 6.140303 AGTGACAATGGACAAATATGCATC 57.860 37.500 0.19 0.00 0.00 3.91
2004 2091 2.816113 AGGAGGGAGGGATAAGTAGGA 58.184 52.381 0.00 0.00 0.00 2.94
2094 2190 5.163405 GGTAGCACAAGAGAATGGATGTAGA 60.163 44.000 0.00 0.00 0.00 2.59
2307 2415 6.013725 CCCTGAGTATGCCATGGTACTTATAA 60.014 42.308 14.67 1.81 31.61 0.98


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.