Multiple sequence alignment - TraesCS5D01G459300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G459300 chr5D 100.000 2264 0 0 1 2264 503339901 503342164 0 4181
1 TraesCS5D01G459300 chr5D 99.240 2237 13 4 1 2234 299971532 299969297 0 4034
2 TraesCS5D01G459300 chr5D 98.631 2265 29 2 1 2264 503313962 503316225 0 4010
3 TraesCS5D01G459300 chr5D 97.926 2266 40 7 1 2264 6252813 6250553 0 3917
4 TraesCS5D01G459300 chrUn 98.411 2266 31 4 1 2264 261568232 261565970 0 3980
5 TraesCS5D01G459300 chr5B 98.326 2270 23 6 1 2264 57514662 57512402 0 3967
6 TraesCS5D01G459300 chr5A 98.578 2251 18 5 19 2264 559031468 559029227 0 3967
7 TraesCS5D01G459300 chr3A 98.149 2269 27 7 1 2264 105556495 105554237 0 3943
8 TraesCS5D01G459300 chr1D 97.222 2268 50 9 1 2264 51831501 51829243 0 3827


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G459300 chr5D 503339901 503342164 2263 False 4181 4181 100.000 1 2264 1 chr5D.!!$F2 2263
1 TraesCS5D01G459300 chr5D 299969297 299971532 2235 True 4034 4034 99.240 1 2234 1 chr5D.!!$R2 2233
2 TraesCS5D01G459300 chr5D 503313962 503316225 2263 False 4010 4010 98.631 1 2264 1 chr5D.!!$F1 2263
3 TraesCS5D01G459300 chr5D 6250553 6252813 2260 True 3917 3917 97.926 1 2264 1 chr5D.!!$R1 2263
4 TraesCS5D01G459300 chrUn 261565970 261568232 2262 True 3980 3980 98.411 1 2264 1 chrUn.!!$R1 2263
5 TraesCS5D01G459300 chr5B 57512402 57514662 2260 True 3967 3967 98.326 1 2264 1 chr5B.!!$R1 2263
6 TraesCS5D01G459300 chr5A 559029227 559031468 2241 True 3967 3967 98.578 19 2264 1 chr5A.!!$R1 2245
7 TraesCS5D01G459300 chr3A 105554237 105556495 2258 True 3943 3943 98.149 1 2264 1 chr3A.!!$R1 2263
8 TraesCS5D01G459300 chr1D 51829243 51831501 2258 True 3827 3827 97.222 1 2264 1 chr1D.!!$R1 2263

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
253 257 6.248433 ACCAAGAATGTGAGACCATTAACAT 58.752 36.0 0.0 0.0 35.24 2.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1959 1973 0.249657 CTTGAGCTACGGAGGATGCC 60.25 60.0 0.0 0.0 0.0 4.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
253 257 6.248433 ACCAAGAATGTGAGACCATTAACAT 58.752 36.000 0.00 0.0 35.24 2.71
1033 1046 9.959749 GATACTCTGAGATAGAACGAGAAAAAT 57.040 33.333 12.44 0.0 34.32 1.82
1131 1144 3.242011 ACAAAGGGCAATGAATCAGGTT 58.758 40.909 0.00 0.0 0.00 3.50
1257 1270 0.623324 TCGGGTCCCTGGAATGGAAT 60.623 55.000 6.29 0.0 30.32 3.01
1334 1347 1.616159 TTTTTCCCCTTGCTTCCGAG 58.384 50.000 0.00 0.0 0.00 4.63
1637 1651 7.035612 AGTTTTGTAAAAGCAACAGGAAGAAG 58.964 34.615 0.00 0.0 0.00 2.85
1959 1973 6.018994 GTGTTTATGTAGCTATCGGTCAAAGG 60.019 42.308 0.00 0.0 0.00 3.11
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1131 1144 1.146485 TTGGAAAACCCGCTGTCGA 59.854 52.632 0.0 0.0 38.10 4.20
1334 1347 6.017109 TGCCATTAGTGTTTCTGACTCTTTTC 60.017 38.462 0.0 0.0 34.21 2.29
1637 1651 0.818296 ACTCACGGGTATCTGAGCAC 59.182 55.000 0.0 0.0 37.96 4.40
1959 1973 0.249657 CTTGAGCTACGGAGGATGCC 60.250 60.000 0.0 0.0 0.00 4.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.