Multiple sequence alignment - TraesCS5D01G459200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G459200 chr5D 100.000 2246 0 0 1 2246 503338098 503340343 0 4148
1 TraesCS5D01G459200 chr5D 97.830 2258 33 9 1 2246 6254625 6252372 0 3884
2 TraesCS5D01G459200 chr5D 97.953 2247 33 8 1 2243 503312163 503314400 0 3882
3 TraesCS5D01G459200 chr3A 98.315 2255 24 9 1 2246 105558302 105556053 0 3941
4 TraesCS5D01G459200 chr3A 94.517 766 34 6 1 765 673485178 673485936 0 1175
5 TraesCS5D01G459200 chr3A 91.415 629 28 9 776 1399 673485989 673486596 0 839
6 TraesCS5D01G459200 chr7B 98.223 2251 30 8 1 2246 662756374 662754129 0 3927
7 TraesCS5D01G459200 chr5B 98.092 2254 31 8 1 2246 57516468 57514219 0 3914
8 TraesCS5D01G459200 chr1B 98.044 2250 34 8 1 2246 633715632 633717875 0 3903
9 TraesCS5D01G459200 chr3B 98.467 2022 21 7 1 2016 101923534 101925551 0 3554
10 TraesCS5D01G459200 chr7A 96.708 1276 33 8 974 2246 537841776 537840507 0 2115
11 TraesCS5D01G459200 chr7A 97.791 815 12 2 214 1024 706286307 706285495 0 1400
12 TraesCS5D01G459200 chr2A 89.770 1261 84 22 992 2246 719801996 719803217 0 1572


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G459200 chr5D 503338098 503340343 2245 False 4148 4148 100.000 1 2246 1 chr5D.!!$F2 2245
1 TraesCS5D01G459200 chr5D 6252372 6254625 2253 True 3884 3884 97.830 1 2246 1 chr5D.!!$R1 2245
2 TraesCS5D01G459200 chr5D 503312163 503314400 2237 False 3882 3882 97.953 1 2243 1 chr5D.!!$F1 2242
3 TraesCS5D01G459200 chr3A 105556053 105558302 2249 True 3941 3941 98.315 1 2246 1 chr3A.!!$R1 2245
4 TraesCS5D01G459200 chr3A 673485178 673486596 1418 False 1007 1175 92.966 1 1399 2 chr3A.!!$F1 1398
5 TraesCS5D01G459200 chr7B 662754129 662756374 2245 True 3927 3927 98.223 1 2246 1 chr7B.!!$R1 2245
6 TraesCS5D01G459200 chr5B 57514219 57516468 2249 True 3914 3914 98.092 1 2246 1 chr5B.!!$R1 2245
7 TraesCS5D01G459200 chr1B 633715632 633717875 2243 False 3903 3903 98.044 1 2246 1 chr1B.!!$F1 2245
8 TraesCS5D01G459200 chr3B 101923534 101925551 2017 False 3554 3554 98.467 1 2016 1 chr3B.!!$F1 2015
9 TraesCS5D01G459200 chr7A 537840507 537841776 1269 True 2115 2115 96.708 974 2246 1 chr7A.!!$R1 1272
10 TraesCS5D01G459200 chr7A 706285495 706286307 812 True 1400 1400 97.791 214 1024 1 chr7A.!!$R2 810
11 TraesCS5D01G459200 chr2A 719801996 719803217 1221 False 1572 1572 89.770 992 2246 1 chr2A.!!$F1 1254

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
692 702 5.013704 TCCTCTTTTATGCAGGTTTCCACTA 59.986 40.0 0.0 0.0 0.0 2.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1746 1813 0.109723 TTAAGCCCGAAACTGCCAGT 59.89 50.0 0.0 0.0 0.0 4.0 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
692 702 5.013704 TCCTCTTTTATGCAGGTTTCCACTA 59.986 40.000 0.00 0.0 0.00 2.74
843 897 7.663081 CCGATATATGGATATGGAATTCCCTTG 59.337 40.741 21.90 0.0 35.38 3.61
1006 1060 4.115516 CGAGGAACTACTCACCATGAATG 58.884 47.826 0.00 0.0 41.55 2.67
1489 1550 6.171213 CGTCCTTAGTTTAGGAAAGTGGAAT 58.829 40.000 0.00 0.0 45.62 3.01
1746 1813 0.991146 TTTAGCTCACTGGCCATCCA 59.009 50.000 5.51 0.0 40.85 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
168 169 9.675464 TTGGAGTTGGTTTAATATATTTCTCGT 57.325 29.630 2.68 0.00 0.00 4.18
477 486 4.825634 CAGATTATCTGGAACCATGCATGT 59.174 41.667 24.58 7.78 40.71 3.21
796 848 7.113658 TCGGATTAGATAATGAATCTAGCCC 57.886 40.000 8.92 7.19 45.75 5.19
843 897 6.903883 ATGTGAATTGTCCGAACTACATAC 57.096 37.500 0.00 0.00 0.00 2.39
1746 1813 0.109723 TTAAGCCCGAAACTGCCAGT 59.890 50.000 0.00 0.00 0.00 4.00
1794 1862 4.332428 ACACCAACCACTACAGTTAGAC 57.668 45.455 0.00 0.00 0.00 2.59


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.