AutoCloner

Multiple sequence alignment - TraesCS5D01G458900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)

BLAST Results

Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

	qseqid	sseqid	percentage.identical	alignment.length	no.mismatch	no.gap.openings	qstart	qend	sstart	send	evalue	bitscore
0	TraesCS5D01G458900	chr5D	100.000	3515	0	0	1	3515	503314316	503317830	0.000000e+00	6492
1	TraesCS5D01G458900	chr5D	98.437	3518	43	6	1	3515	503340255	503343763	0.000000e+00	6181
2	TraesCS5D01G458900	chr5D	97.925	3518	65	8	1	3515	6252459	6248947	0.000000e+00	6085
3	TraesCS5D01G458900	chr1A	97.990	3532	49	9	1	3515	554482828	554486354	0.000000e+00	6109
4	TraesCS5D01G458900	chr3A	97.842	3522	59	8	1	3515	105556140	105552629	0.000000e+00	6067
5	TraesCS5D01G458900	chr1D	97.560	3524	63	10	1	3515	254460226	254463735	0.000000e+00	6010
6	TraesCS5D01G458900	chr1D	96.875	3520	92	12	1	3515	51831148	51827642	0.000000e+00	5875
7	TraesCS5D01G458900	chr7A	96.562	3519	100	14	1	3515	537840594	537837093	0.000000e+00	5808
8	TraesCS5D01G458900	chr4D	96.276	3518	115	14	1	3515	19901540	19905044	0.000000e+00	5757
9	TraesCS5D01G458900	chr2B	98.344	3080	46	5	441	3515	683728694	683731773	0.000000e+00	5400
10	TraesCS5D01G458900	chr2B	97.329	599	14	2	2768	3364	5170516	5171114	0.000000e+00	1016
11	TraesCS5D01G458900	chr5A	98.160	3097	40	7	1	3090	559031132	559028046	0.000000e+00	5387
12	TraesCS5D01G458900	chr5A	94.949	198	5	2	1	197	167504966	167505159	4.410000e-79	305
13	TraesCS5D01G458900	chr7B	96.463	1131	25	7	1	1127	662754217	662753098	0.000000e+00	1853

These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

	query	scaffold	start	end	length	rev.comp	avg.bitscore	max.bitscore	avg.percent.identical	query.start	query.end	num_hsp	groupid	homo_length
0	TraesCS5D01G458900	chr5D	503314316	503317830	3514	False	6492	6492	100.000	1	3515	1	chr5D.!!$F1	3514
1	TraesCS5D01G458900	chr5D	503340255	503343763	3508	False	6181	6181	98.437	1	3515	1	chr5D.!!$F2	3514
2	TraesCS5D01G458900	chr5D	6248947	6252459	3512	True	6085	6085	97.925	1	3515	1	chr5D.!!$R1	3514
3	TraesCS5D01G458900	chr1A	554482828	554486354	3526	False	6109	6109	97.990	1	3515	1	chr1A.!!$F1	3514
4	TraesCS5D01G458900	chr3A	105552629	105556140	3511	True	6067	6067	97.842	1	3515	1	chr3A.!!$R1	3514
5	TraesCS5D01G458900	chr1D	254460226	254463735	3509	False	6010	6010	97.560	1	3515	1	chr1D.!!$F1	3514
6	TraesCS5D01G458900	chr1D	51827642	51831148	3506	True	5875	5875	96.875	1	3515	1	chr1D.!!$R1	3514
7	TraesCS5D01G458900	chr7A	537837093	537840594	3501	True	5808	5808	96.562	1	3515	1	chr7A.!!$R1	3514
8	TraesCS5D01G458900	chr4D	19901540	19905044	3504	False	5757	5757	96.276	1	3515	1	chr4D.!!$F1	3514
9	TraesCS5D01G458900	chr2B	683728694	683731773	3079	False	5400	5400	98.344	441	3515	1	chr2B.!!$F2	3074
10	TraesCS5D01G458900	chr2B	5170516	5171114	598	False	1016	1016	97.329	2768	3364	1	chr2B.!!$F1	596
11	TraesCS5D01G458900	chr5A	559028046	559031132	3086	True	5387	5387	98.160	1	3090	1	chr5A.!!$R1	3089
12	TraesCS5D01G458900	chr7B	662753098	662754217	1119	True	1853	1853	96.463	1	1127	1	chr7B.!!$R1	1126

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
592	618	1.003580	GAGGGACCATTGAGCAACTCA	59.996	52.381	0.0	0.0	38.87	3.41	F
1023	1050	1.939838	GCAACCCTTCGAGTCAACGAT	60.940	52.381	0.0	0.0	41.82	3.73	F

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
1522	1549	2.358898	CTGTGGCTACTGTTGTTTTGCT	59.641	45.455	0.64	0.0	0.0	3.91	R
2952	2986	2.862850	TCCCCTAGTTACCCCTCTTC	57.137	55.000	0.00	0.0	0.0	2.87	R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Hairpin	End Stability
85	88	1.266178	GCACCCTGCCCTTTTGTAAT	58.734	50.000	37.42	1.89
473	499	4.816925	GGTTCGGGAAGAGATCATAAAAGG	59.183	45.833	0.00	3.11
592	618	1.003580	GAGGGACCATTGAGCAACTCA	59.996	52.381	38.87	3.41
1023	1050	1.939838	GCAACCCTTCGAGTCAACGAT	60.940	52.381	41.82	3.73
1159	1186	8.050778	TGGTGAAATAATGTCAGGTGAATTAC	57.949	34.615	0.00	1.89
1522	1549	7.402071	AGTTAATTATTGGGGACAGACAGACTA	59.598	37.037	44.54	2.59
1531	1558	4.127171	GGACAGACAGACTAGCAAAACAA	58.873	43.478	0.00	2.83
1713	1740	6.308015	TCACCTGCTACATTACAATACCTT	57.692	37.500	0.00	3.50
1773	1800	4.946766	CGCGAACGGCATACTTTC	57.053	55.556	43.84	2.62
1920	1948	6.796426	AGAAAGAGCCGCTAAATTAAATTCC	58.204	36.000	0.00	3.01
2570	2598	5.119694	AGAATAGGAATCGTTGAGAAAGCC	58.880	41.667	0.00	4.35
2887	2921	0.469331	TATGGAGGCGGTAGTGGGAG	60.469	60.000	0.00	4.30
2952	2986	7.819900	ACCAAACTGCTCTATACTCTTAAACTG	59.180	37.037	0.00	3.16
2968	3002	6.439692	TCTTAAACTGAAGAGGGGTAACTAGG	59.560	42.308	31.72	3.02

Showing 1 to 14 of 14 entries

Previous1Next

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Hairpin	End Stability
81	84	2.792674	TCGTCGATTCGGCATTGATTAC	59.207	45.455	11.66	0.00	1.89
85	88	0.804544	GGTCGTCGATTCGGCATTGA	60.805	55.000	11.66	37.15	2.57
278	290	3.840666	ACATTAAGAGGACTCTTCTGCCA	59.159	43.478	17.16	46.13	4.92
515	541	9.354673	TCAAGATCCTCTGTTTTTGTTTATCTT	57.645	29.630	0.00	32.81	2.40
569	595	3.118531	AGTTGCTCAATGGTCCCTCTAT	58.881	45.455	0.00	0.00	1.98
715	741	9.518906	GGTTTCGTTTTTAGACTTTTCCAATTA	57.481	29.630	0.00	0.00	1.40
1023	1050	5.521010	ACGTTCGCGGAGAATTTTATGAATA	59.479	36.000	6.13	46.45	1.75
1159	1186	4.806247	CCTAGTACCTTCTGCAAATTCGAG	59.194	45.833	0.00	0.00	4.04
1522	1549	2.358898	CTGTGGCTACTGTTGTTTTGCT	59.641	45.455	0.64	0.00	3.91
1531	1558	5.187772	TGAGAATTGTATCTGTGGCTACTGT	59.812	40.000	0.64	0.00	3.55
1920	1948	4.571176	GTCATACTTCCTTCGCCTAAAAGG	59.429	45.833	0.00	43.94	3.11
2887	2921	4.629523	TGGGGTTGCGGGTTCGAC	62.630	66.667	0.00	39.00	4.20
2952	2986	2.862850	TCCCCTAGTTACCCCTCTTC	57.137	55.000	0.00	0.00	2.87
2968	3002	4.386711	CGTATCCAACCCTCTTTTATCCC	58.613	47.826	0.00	0.00	3.85

Showing 1 to 14 of 14 entries

Previous1Next

Based at the University of Bristol with support from BBSRC.

AutoCloner maintained by Alex Coulton.