Multiple sequence alignment - TraesCS5D01G458900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G458900 chr5D 100.000 3515 0 0 1 3515 503314316 503317830 0.000000e+00 6492
1 TraesCS5D01G458900 chr5D 98.437 3518 43 6 1 3515 503340255 503343763 0.000000e+00 6181
2 TraesCS5D01G458900 chr5D 97.925 3518 65 8 1 3515 6252459 6248947 0.000000e+00 6085
3 TraesCS5D01G458900 chr1A 97.990 3532 49 9 1 3515 554482828 554486354 0.000000e+00 6109
4 TraesCS5D01G458900 chr3A 97.842 3522 59 8 1 3515 105556140 105552629 0.000000e+00 6067
5 TraesCS5D01G458900 chr1D 97.560 3524 63 10 1 3515 254460226 254463735 0.000000e+00 6010
6 TraesCS5D01G458900 chr1D 96.875 3520 92 12 1 3515 51831148 51827642 0.000000e+00 5875
7 TraesCS5D01G458900 chr7A 96.562 3519 100 14 1 3515 537840594 537837093 0.000000e+00 5808
8 TraesCS5D01G458900 chr4D 96.276 3518 115 14 1 3515 19901540 19905044 0.000000e+00 5757
9 TraesCS5D01G458900 chr2B 98.344 3080 46 5 441 3515 683728694 683731773 0.000000e+00 5400
10 TraesCS5D01G458900 chr2B 97.329 599 14 2 2768 3364 5170516 5171114 0.000000e+00 1016
11 TraesCS5D01G458900 chr5A 98.160 3097 40 7 1 3090 559031132 559028046 0.000000e+00 5387
12 TraesCS5D01G458900 chr5A 94.949 198 5 2 1 197 167504966 167505159 4.410000e-79 305
13 TraesCS5D01G458900 chr7B 96.463 1131 25 7 1 1127 662754217 662753098 0.000000e+00 1853


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G458900 chr5D 503314316 503317830 3514 False 6492 6492 100.000 1 3515 1 chr5D.!!$F1 3514
1 TraesCS5D01G458900 chr5D 503340255 503343763 3508 False 6181 6181 98.437 1 3515 1 chr5D.!!$F2 3514
2 TraesCS5D01G458900 chr5D 6248947 6252459 3512 True 6085 6085 97.925 1 3515 1 chr5D.!!$R1 3514
3 TraesCS5D01G458900 chr1A 554482828 554486354 3526 False 6109 6109 97.990 1 3515 1 chr1A.!!$F1 3514
4 TraesCS5D01G458900 chr3A 105552629 105556140 3511 True 6067 6067 97.842 1 3515 1 chr3A.!!$R1 3514
5 TraesCS5D01G458900 chr1D 254460226 254463735 3509 False 6010 6010 97.560 1 3515 1 chr1D.!!$F1 3514
6 TraesCS5D01G458900 chr1D 51827642 51831148 3506 True 5875 5875 96.875 1 3515 1 chr1D.!!$R1 3514
7 TraesCS5D01G458900 chr7A 537837093 537840594 3501 True 5808 5808 96.562 1 3515 1 chr7A.!!$R1 3514
8 TraesCS5D01G458900 chr4D 19901540 19905044 3504 False 5757 5757 96.276 1 3515 1 chr4D.!!$F1 3514
9 TraesCS5D01G458900 chr2B 683728694 683731773 3079 False 5400 5400 98.344 441 3515 1 chr2B.!!$F2 3074
10 TraesCS5D01G458900 chr2B 5170516 5171114 598 False 1016 1016 97.329 2768 3364 1 chr2B.!!$F1 596
11 TraesCS5D01G458900 chr5A 559028046 559031132 3086 True 5387 5387 98.160 1 3090 1 chr5A.!!$R1 3089
12 TraesCS5D01G458900 chr7B 662753098 662754217 1119 True 1853 1853 96.463 1 1127 1 chr7B.!!$R1 1126

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
592 618 1.003580 GAGGGACCATTGAGCAACTCA 59.996 52.381 0.0 0.0 38.87 3.41 F
1023 1050 1.939838 GCAACCCTTCGAGTCAACGAT 60.940 52.381 0.0 0.0 41.82 3.73 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1522 1549 2.358898 CTGTGGCTACTGTTGTTTTGCT 59.641 45.455 0.64 0.0 0.0 3.91 R
2952 2986 2.862850 TCCCCTAGTTACCCCTCTTC 57.137 55.000 0.00 0.0 0.0 2.87 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
85 88 1.266178 GCACCCTGCCCTTTTGTAAT 58.734 50.000 0.0 0.0 37.42 1.89
473 499 4.816925 GGTTCGGGAAGAGATCATAAAAGG 59.183 45.833 0.0 0.0 0.00 3.11
592 618 1.003580 GAGGGACCATTGAGCAACTCA 59.996 52.381 0.0 0.0 38.87 3.41
1023 1050 1.939838 GCAACCCTTCGAGTCAACGAT 60.940 52.381 0.0 0.0 41.82 3.73
1159 1186 8.050778 TGGTGAAATAATGTCAGGTGAATTAC 57.949 34.615 0.0 0.0 0.00 1.89
1522 1549 7.402071 AGTTAATTATTGGGGACAGACAGACTA 59.598 37.037 0.0 0.0 44.54 2.59
1531 1558 4.127171 GGACAGACAGACTAGCAAAACAA 58.873 43.478 0.0 0.0 0.00 2.83
1713 1740 6.308015 TCACCTGCTACATTACAATACCTT 57.692 37.500 0.0 0.0 0.00 3.50
1773 1800 4.946766 CGCGAACGGCATACTTTC 57.053 55.556 0.0 0.0 43.84 2.62
1920 1948 6.796426 AGAAAGAGCCGCTAAATTAAATTCC 58.204 36.000 0.0 0.0 0.00 3.01
2570 2598 5.119694 AGAATAGGAATCGTTGAGAAAGCC 58.880 41.667 0.0 0.0 0.00 4.35
2887 2921 0.469331 TATGGAGGCGGTAGTGGGAG 60.469 60.000 0.0 0.0 0.00 4.30
2952 2986 7.819900 ACCAAACTGCTCTATACTCTTAAACTG 59.180 37.037 0.0 0.0 0.00 3.16
2968 3002 6.439692 TCTTAAACTGAAGAGGGGTAACTAGG 59.560 42.308 0.0 0.0 31.72 3.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
81 84 2.792674 TCGTCGATTCGGCATTGATTAC 59.207 45.455 11.66 0.0 0.00 1.89
85 88 0.804544 GGTCGTCGATTCGGCATTGA 60.805 55.000 11.66 0.0 37.15 2.57
278 290 3.840666 ACATTAAGAGGACTCTTCTGCCA 59.159 43.478 17.16 0.0 46.13 4.92
515 541 9.354673 TCAAGATCCTCTGTTTTTGTTTATCTT 57.645 29.630 0.00 0.0 32.81 2.40
569 595 3.118531 AGTTGCTCAATGGTCCCTCTAT 58.881 45.455 0.00 0.0 0.00 1.98
715 741 9.518906 GGTTTCGTTTTTAGACTTTTCCAATTA 57.481 29.630 0.00 0.0 0.00 1.40
1023 1050 5.521010 ACGTTCGCGGAGAATTTTATGAATA 59.479 36.000 6.13 0.0 46.45 1.75
1159 1186 4.806247 CCTAGTACCTTCTGCAAATTCGAG 59.194 45.833 0.00 0.0 0.00 4.04
1522 1549 2.358898 CTGTGGCTACTGTTGTTTTGCT 59.641 45.455 0.64 0.0 0.00 3.91
1531 1558 5.187772 TGAGAATTGTATCTGTGGCTACTGT 59.812 40.000 0.64 0.0 0.00 3.55
1920 1948 4.571176 GTCATACTTCCTTCGCCTAAAAGG 59.429 45.833 0.00 0.0 43.94 3.11
2887 2921 4.629523 TGGGGTTGCGGGTTCGAC 62.630 66.667 0.00 0.0 39.00 4.20
2952 2986 2.862850 TCCCCTAGTTACCCCTCTTC 57.137 55.000 0.00 0.0 0.00 2.87
2968 3002 4.386711 CGTATCCAACCCTCTTTTATCCC 58.613 47.826 0.00 0.0 0.00 3.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.