Multiple sequence alignment - TraesCS5D01G458800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G458800 chr5D 100.000 2264 0 0 1 2264 503313962 503316225 0 4181
1 TraesCS5D01G458800 chr5D 98.631 2265 29 2 1 2264 503339901 503342164 0 4010
2 TraesCS5D01G458800 chr5D 98.570 2238 26 6 1 2234 299971532 299969297 0 3951
3 TraesCS5D01G458800 chr5D 97.485 2266 50 7 1 2264 6252813 6250553 0 3862
4 TraesCS5D01G458800 chrUn 97.969 2265 43 3 1 2264 261568232 261565970 0 3925
5 TraesCS5D01G458800 chr5A 98.002 2252 29 6 19 2264 559031468 559029227 0 3895
6 TraesCS5D01G458800 chr1D 96.736 2267 63 9 1 2264 51831501 51829243 0 3766
7 TraesCS5D01G458800 chr7A 96.648 2267 66 9 1 2264 537840948 537838689 0 3757
8 TraesCS5D01G458800 chr4D 95.942 2267 80 10 1 2264 19901185 19903442 0 3666
9 TraesCS5D01G458800 chr4A 95.522 2032 72 8 1 2029 309445949 309443934 0 3230
10 TraesCS5D01G458800 chr6B 96.942 654 11 3 1 653 450091681 450091036 0 1088


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G458800 chr5D 503313962 503316225 2263 False 4181 4181 100.000 1 2264 1 chr5D.!!$F1 2263
1 TraesCS5D01G458800 chr5D 503339901 503342164 2263 False 4010 4010 98.631 1 2264 1 chr5D.!!$F2 2263
2 TraesCS5D01G458800 chr5D 299969297 299971532 2235 True 3951 3951 98.570 1 2234 1 chr5D.!!$R2 2233
3 TraesCS5D01G458800 chr5D 6250553 6252813 2260 True 3862 3862 97.485 1 2264 1 chr5D.!!$R1 2263
4 TraesCS5D01G458800 chrUn 261565970 261568232 2262 True 3925 3925 97.969 1 2264 1 chrUn.!!$R1 2263
5 TraesCS5D01G458800 chr5A 559029227 559031468 2241 True 3895 3895 98.002 19 2264 1 chr5A.!!$R1 2245
6 TraesCS5D01G458800 chr1D 51829243 51831501 2258 True 3766 3766 96.736 1 2264 1 chr1D.!!$R1 2263
7 TraesCS5D01G458800 chr7A 537838689 537840948 2259 True 3757 3757 96.648 1 2264 1 chr7A.!!$R1 2263
8 TraesCS5D01G458800 chr4D 19901185 19903442 2257 False 3666 3666 95.942 1 2264 1 chr4D.!!$F1 2263
9 TraesCS5D01G458800 chr4A 309443934 309445949 2015 True 3230 3230 95.522 1 2029 1 chr4A.!!$R1 2028
10 TraesCS5D01G458800 chr6B 450091036 450091681 645 True 1088 1088 96.942 1 653 1 chr6B.!!$R1 652

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
946 965 1.00358 GAGGGACCATTGAGCAACTCA 59.996 52.381 0.0 0.0 38.87 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1876 1898 2.358898 CTGTGGCTACTGTTGTTTTGCT 59.641 45.455 0.64 0.0 0.0 3.91 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
439 443 1.266178 GCACCCTGCCCTTTTGTAAT 58.734 50.000 0.0 0.0 37.42 1.89
827 845 4.816925 GGTTCGGGAAGAGATCATAAAAGG 59.183 45.833 0.0 0.0 0.00 3.11
946 965 1.003580 GAGGGACCATTGAGCAACTCA 59.996 52.381 0.0 0.0 38.87 3.41
1377 1399 1.939838 GCAACCCTTCGAGTCAACGAT 60.940 52.381 0.0 0.0 41.82 3.73
1513 1535 8.050778 TGGTGAAATAATGTCAGGTGAATTAC 57.949 34.615 0.0 0.0 0.00 1.89
1876 1898 7.402071 AGTTAATTATTGGGGACAGACAGACTA 59.598 37.037 0.0 0.0 44.54 2.59
1885 1907 4.127171 GGACAGACAGACTAGCAAAACAA 58.873 43.478 0.0 0.0 0.00 2.83
2067 2089 6.308015 TCACCTGCTACATTACAATACCTT 57.692 37.500 0.0 0.0 0.00 3.50
2127 2149 4.946766 CGCGAACGGCATACTTTC 57.053 55.556 0.0 0.0 43.84 2.62
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
435 439 2.792674 TCGTCGATTCGGCATTGATTAC 59.207 45.455 11.66 0.0 0.00 1.89
439 443 0.804544 GGTCGTCGATTCGGCATTGA 60.805 55.000 11.66 0.0 37.15 2.57
632 639 3.840666 ACATTAAGAGGACTCTTCTGCCA 59.159 43.478 17.16 0.0 46.13 4.92
869 888 9.354673 TCAAGATCCTCTGTTTTTGTTTATCTT 57.645 29.630 0.00 0.0 32.81 2.40
923 942 3.118531 AGTTGCTCAATGGTCCCTCTAT 58.881 45.455 0.00 0.0 0.00 1.98
1069 1088 9.518906 GGTTTCGTTTTTAGACTTTTCCAATTA 57.481 29.630 0.00 0.0 0.00 1.40
1377 1399 5.521010 ACGTTCGCGGAGAATTTTATGAATA 59.479 36.000 6.13 0.0 46.45 1.75
1513 1535 4.806247 CCTAGTACCTTCTGCAAATTCGAG 59.194 45.833 0.00 0.0 0.00 4.04
1876 1898 2.358898 CTGTGGCTACTGTTGTTTTGCT 59.641 45.455 0.64 0.0 0.00 3.91
1885 1907 5.187772 TGAGAATTGTATCTGTGGCTACTGT 59.812 40.000 0.64 0.0 0.00 3.55


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.