Multiple sequence alignment - TraesCS5D01G458700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G458700 chr5D 100.000 2174 0 0 1 2174 503313499 503311326 0.000000e+00 4015
1 TraesCS5D01G458700 chr5D 98.394 2180 26 4 1 2174 503339437 503337261 0.000000e+00 3823
2 TraesCS5D01G458700 chr5D 97.432 2181 29 3 1 2171 6253279 6255442 0.000000e+00 3692
3 TraesCS5D01G458700 chr3A 98.078 2185 27 6 1 2174 105556960 105559140 0.000000e+00 3788
4 TraesCS5D01G458700 chr1B 97.843 2179 35 5 1 2174 633716968 633714797 0.000000e+00 3753
5 TraesCS5D01G458700 chr3B 98.258 2124 26 4 1 2117 101924873 101922754 0.000000e+00 3707
6 TraesCS5D01G458700 chr3B 85.992 257 15 10 1757 2013 413875548 413875783 2.770000e-64 255
7 TraesCS5D01G458700 chr1D 97.338 2179 46 7 1 2174 51831963 51834134 0.000000e+00 3692
8 TraesCS5D01G458700 chr1D 96.878 2178 35 6 1 2174 254459405 254457257 0.000000e+00 3615
9 TraesCS5D01G458700 chr7B 97.698 2042 35 6 1 2037 662755038 662757072 0.000000e+00 3500
10 TraesCS5D01G458700 chr1A 97.861 2010 33 4 171 2174 554482083 554480078 0.000000e+00 3465
11 TraesCS5D01G458700 chr7A 94.721 663 13 5 1513 2174 537849192 537848551 0.000000e+00 1011


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G458700 chr5D 503311326 503313499 2173 True 4015 4015 100.000 1 2174 1 chr5D.!!$R1 2173
1 TraesCS5D01G458700 chr5D 503337261 503339437 2176 True 3823 3823 98.394 1 2174 1 chr5D.!!$R2 2173
2 TraesCS5D01G458700 chr5D 6253279 6255442 2163 False 3692 3692 97.432 1 2171 1 chr5D.!!$F1 2170
3 TraesCS5D01G458700 chr3A 105556960 105559140 2180 False 3788 3788 98.078 1 2174 1 chr3A.!!$F1 2173
4 TraesCS5D01G458700 chr1B 633714797 633716968 2171 True 3753 3753 97.843 1 2174 1 chr1B.!!$R1 2173
5 TraesCS5D01G458700 chr3B 101922754 101924873 2119 True 3707 3707 98.258 1 2117 1 chr3B.!!$R1 2116
6 TraesCS5D01G458700 chr1D 51831963 51834134 2171 False 3692 3692 97.338 1 2174 1 chr1D.!!$F1 2173
7 TraesCS5D01G458700 chr1D 254457257 254459405 2148 True 3615 3615 96.878 1 2174 1 chr1D.!!$R1 2173
8 TraesCS5D01G458700 chr7B 662755038 662757072 2034 False 3500 3500 97.698 1 2037 1 chr7B.!!$F1 2036
9 TraesCS5D01G458700 chr1A 554480078 554482083 2005 True 3465 3465 97.861 171 2174 1 chr1A.!!$R1 2003
10 TraesCS5D01G458700 chr7A 537848551 537849192 641 True 1011 1011 94.721 1513 2174 1 chr7A.!!$R1 661

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
729 745 1.972207 GCCTGACTCCACCCTCCTTAT 60.972 57.143 0.0 0.0 0.0 1.73 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1543 1565 5.187772 GGCAAATAGGAGGTTTCCAAATTCT 59.812 40.0 0.0 0.0 46.64 2.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
212 221 5.175859 TCGTATTTTACCTTCTGCTTCTGG 58.824 41.667 0.00 0.00 0.00 3.86
423 433 5.908247 ACTTCTAAGCTCTATTGGGGAGAAT 59.092 40.000 0.00 0.00 33.03 2.40
729 745 1.972207 GCCTGACTCCACCCTCCTTAT 60.972 57.143 0.00 0.00 0.00 1.73
914 936 8.648698 TTCCAAAAAGAGTCAATCCAATGATA 57.351 30.769 0.00 0.00 0.00 2.15
940 962 5.966935 CCCTCCATGGATTCACCTATATAGT 59.033 44.000 16.63 0.00 39.86 2.12
1152 1174 3.773560 TGGTAAAAGGATTGGAGTTGGG 58.226 45.455 0.00 0.00 0.00 4.12
1495 1517 3.935203 CCGAACAGCTATGACAACTGAAT 59.065 43.478 9.68 0.44 35.38 2.57
1543 1565 3.327757 AGAAGTGATGAGTACTTGGGCAA 59.672 43.478 0.00 0.00 38.42 4.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
122 127 5.748670 TTATGGACTAGTTGTGGCACTAA 57.251 39.130 19.83 8.69 0.00 2.24
212 221 1.861575 GCTGTAGAAGGTATTGCGAGC 59.138 52.381 0.00 0.00 0.00 5.03
773 789 4.806952 AGCCTAGAGTTGTAGGAGAGAT 57.193 45.455 6.53 0.00 42.18 2.75
906 928 3.882102 TCCATGGAGGGTTATCATTGG 57.118 47.619 11.44 0.00 38.24 3.16
914 936 1.686236 AGGTGAATCCATGGAGGGTT 58.314 50.000 21.33 9.84 45.82 4.11
940 962 1.242989 TTTGCAACATTAGCCGCAGA 58.757 45.000 0.00 0.00 35.47 4.26
1122 1144 9.100197 ACTCCAATCCTTTTACCAATTAACATT 57.900 29.630 0.00 0.00 0.00 2.71
1218 1240 5.123227 ACTGTTGCTTTAGCTTTACTCACA 58.877 37.500 0.00 0.00 42.66 3.58
1458 1480 4.006989 CTGTTCGGAATCCACAAACCATA 58.993 43.478 0.00 0.00 0.00 2.74
1495 1517 6.774170 TGGGTCGTAATTACTATCTTGCTAGA 59.226 38.462 13.56 0.00 34.21 2.43
1543 1565 5.187772 GGCAAATAGGAGGTTTCCAAATTCT 59.812 40.000 0.00 0.00 46.64 2.40
2101 2143 9.139174 GATCAGCAAAAAGAGTATATAGCTCTC 57.861 37.037 12.41 0.00 41.96 3.20


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.