Multiple sequence alignment - TraesCS5D01G458600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G458600 chr5D 100.000 2810 0 0 1 2810 503309769 503312578 0 5190
1 TraesCS5D01G458600 chr5D 97.727 2816 39 7 1 2810 6257006 6254210 0 4822
2 TraesCS5D01G458600 chr5D 98.427 2415 32 5 1 2409 503332385 503334799 0 4244
3 TraesCS5D01G458600 chr5D 98.557 2148 24 5 533 2673 481591752 481593899 0 3788
4 TraesCS5D01G458600 chr5D 99.124 1712 15 0 1099 2810 503336802 503338513 0 3079
5 TraesCS5D01G458600 chr1D 98.321 2680 33 8 1 2673 254452899 254455573 0 4689
6 TraesCS5D01G458600 chr1D 97.133 1814 42 8 998 2810 51834691 51832887 0 3053
7 TraesCS5D01G458600 chr1D 95.972 1018 30 8 1 1011 51835863 51834850 0 1642
8 TraesCS5D01G458600 chr3A 98.896 1812 19 1 1000 2810 105559698 105557887 0 3234
9 TraesCS5D01G458600 chr1A 98.626 1819 23 2 994 2810 554479513 554481331 0 3219
10 TraesCS5D01G458600 chr1B 98.129 1817 30 3 994 2810 633714234 633716046 0 3164
11 TraesCS5D01G458600 chr1B 97.539 1016 19 5 1 1011 633713064 633714078 0 1733
12 TraesCS5D01G458600 chrUn 98.692 1605 15 4 122 1720 385511363 385509759 0 2843
13 TraesCS5D01G458600 chr3B 98.913 1196 13 0 1615 2810 101922754 101923949 0 2137
14 TraesCS5D01G458600 chr6B 98.035 1018 13 4 1 1011 18742188 18741171 0 1762
15 TraesCS5D01G458600 chr7B 97.348 1018 19 6 1 1011 137682500 137683516 0 1724
16 TraesCS5D01G458600 chr4D 96.376 1021 25 9 1 1011 19886319 19887337 0 1670
17 TraesCS5D01G458600 chr7A 94.502 673 34 2 2138 2810 710799143 710798474 0 1035


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G458600 chr5D 503309769 503312578 2809 False 5190.0 5190 100.0000 1 2810 1 chr5D.!!$F2 2809
1 TraesCS5D01G458600 chr5D 6254210 6257006 2796 True 4822.0 4822 97.7270 1 2810 1 chr5D.!!$R1 2809
2 TraesCS5D01G458600 chr5D 481591752 481593899 2147 False 3788.0 3788 98.5570 533 2673 1 chr5D.!!$F1 2140
3 TraesCS5D01G458600 chr5D 503332385 503338513 6128 False 3661.5 4244 98.7755 1 2810 2 chr5D.!!$F3 2809
4 TraesCS5D01G458600 chr1D 254452899 254455573 2674 False 4689.0 4689 98.3210 1 2673 1 chr1D.!!$F1 2672
5 TraesCS5D01G458600 chr1D 51832887 51835863 2976 True 2347.5 3053 96.5525 1 2810 2 chr1D.!!$R1 2809
6 TraesCS5D01G458600 chr3A 105557887 105559698 1811 True 3234.0 3234 98.8960 1000 2810 1 chr3A.!!$R1 1810
7 TraesCS5D01G458600 chr1A 554479513 554481331 1818 False 3219.0 3219 98.6260 994 2810 1 chr1A.!!$F1 1816
8 TraesCS5D01G458600 chr1B 633713064 633716046 2982 False 2448.5 3164 97.8340 1 2810 2 chr1B.!!$F1 2809
9 TraesCS5D01G458600 chrUn 385509759 385511363 1604 True 2843.0 2843 98.6920 122 1720 1 chrUn.!!$R1 1598
10 TraesCS5D01G458600 chr3B 101922754 101923949 1195 False 2137.0 2137 98.9130 1615 2810 1 chr3B.!!$F1 1195
11 TraesCS5D01G458600 chr6B 18741171 18742188 1017 True 1762.0 1762 98.0350 1 1011 1 chr6B.!!$R1 1010
12 TraesCS5D01G458600 chr7B 137682500 137683516 1016 False 1724.0 1724 97.3480 1 1011 1 chr7B.!!$F1 1010
13 TraesCS5D01G458600 chr4D 19886319 19887337 1018 False 1670.0 1670 96.3760 1 1011 1 chr4D.!!$F1 1010
14 TraesCS5D01G458600 chr7A 710798474 710799143 669 True 1035.0 1035 94.5020 2138 2810 1 chr7A.!!$R1 672

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
584 586 0.597637 CGGACTATTGCGAGCGGAAT 60.598 55.0 13.77 13.77 39.29 3.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2403 3301 0.400213 AAGAGCACCCGACCAATTCA 59.6 50.0 0.0 0.0 0.0 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
141 143 9.326413 TGTTATAAGAGCAGCTAAACCTTATTC 57.674 33.333 15.68 11.41 33.59 1.75
542 544 6.017852 GGTTTCCGAAGATGGAATGTCTAATC 60.018 42.308 0.00 0.00 46.94 1.75
584 586 0.597637 CGGACTATTGCGAGCGGAAT 60.598 55.000 13.77 13.77 39.29 3.01
610 612 2.237143 AGGACGAGCTTTGGATGAATCA 59.763 45.455 0.00 0.00 0.00 2.57
1079 1444 7.575505 TCCGTAATGGAATGGTAGGATTAAAA 58.424 34.615 0.00 0.00 46.38 1.52
1521 1887 5.511888 CCCAAAAAGAGATGTGGCAATCTTT 60.512 40.000 11.64 11.13 42.30 2.52
1629 1995 9.139174 GATCAGCAAAAAGAGTATATAGCTCTC 57.861 37.037 12.41 0.00 41.96 3.20
2187 3085 5.187772 GGCAAATAGGAGGTTTCCAAATTCT 59.812 40.000 0.00 0.00 46.64 2.40
2235 3133 6.774170 TGGGTCGTAATTACTATCTTGCTAGA 59.226 38.462 13.56 0.00 34.21 2.43
2272 3170 4.006989 CTGTTCGGAATCCACAAACCATA 58.993 43.478 0.00 0.00 0.00 2.74
2608 6305 9.100197 ACTCCAATCCTTTTACCAATTAACATT 57.900 29.630 0.00 0.00 0.00 2.71
2790 6487 1.242989 TTTGCAACATTAGCCGCAGA 58.757 45.000 0.00 0.00 35.47 4.26
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
112 114 7.996098 AGGTTTAGCTGCTCTTATAACAAAA 57.004 32.000 4.91 0.00 0.00 2.44
141 143 1.741770 GTTGCTCCTGTAGTGGCCG 60.742 63.158 0.00 0.00 0.00 6.13
584 586 1.004560 CCAAAGCTCGTCCTGCTCA 60.005 57.895 0.00 0.00 40.22 4.26
610 612 7.557719 CCCAATAAGATTGCCCGATAATAGATT 59.442 37.037 0.00 0.00 0.00 2.40
711 713 1.296715 CCTCGTAGGGCAGCTTTGT 59.703 57.895 0.00 0.00 0.00 2.83
712 714 0.741221 GACCTCGTAGGGCAGCTTTG 60.741 60.000 2.24 0.00 45.15 2.77
856 866 3.113322 CTCTCATTTCCGACGCGAATAA 58.887 45.455 15.93 0.00 0.00 1.40
1551 1917 3.118775 TCATATATTTGATCCCGCCGAGG 60.119 47.826 0.00 0.00 40.63 4.63
2187 3085 3.327757 AGAAGTGATGAGTACTTGGGCAA 59.672 43.478 0.00 0.00 38.42 4.52
2235 3133 3.935203 CCGAACAGCTATGACAACTGAAT 59.065 43.478 9.68 0.44 35.38 2.57
2403 3301 0.400213 AAGAGCACCCGACCAATTCA 59.600 50.000 0.00 0.00 0.00 2.57
2578 3476 3.773560 TGGTAAAAGGATTGGAGTTGGG 58.226 45.455 0.00 0.00 0.00 4.12


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.