Multiple sequence alignment - TraesCS5D01G458500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G458500 chr5D 100.000 2224 0 0 1 2224 503304532 503302309 0 4108
1 TraesCS5D01G458500 chr5D 98.248 2226 35 4 1 2224 6164252 6166475 0 3892
2 TraesCS5D01G458500 chr5D 97.890 2227 43 4 1 2224 329151189 329153414 0 3849
3 TraesCS5D01G458500 chr5D 98.945 1990 20 1 236 2224 6263515 6265504 0 3557
4 TraesCS5D01G458500 chr5D 98.392 933 12 3 1 931 6262243 6263174 0 1637
5 TraesCS5D01G458500 chr3B 98.922 2227 21 3 1 2224 101907483 101909709 0 3976
6 TraesCS5D01G458500 chr1D 98.518 2227 26 6 1 2224 254447699 254445477 0 3923
7 TraesCS5D01G458500 chr1D 97.710 2227 48 3 1 2224 51859371 51861597 0 3827
8 TraesCS5D01G458500 chr4D 97.088 2198 58 4 29 2224 19881121 19878928 0 3699
9 TraesCS5D01G458500 chr4D 96.707 820 24 3 567 1386 206989030 206989846 0 1362
10 TraesCS5D01G458500 chr4A 97.124 1634 44 3 1 1632 309477658 309479290 0 2754
11 TraesCS5D01G458500 chr1B 94.498 1145 59 4 984 2127 427649981 427648840 0 1762
12 TraesCS5D01G458500 chrUn 98.592 852 11 1 1374 2224 439346595 439345744 0 1506


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G458500 chr5D 503302309 503304532 2223 True 4108 4108 100.0000 1 2224 1 chr5D.!!$R1 2223
1 TraesCS5D01G458500 chr5D 6164252 6166475 2223 False 3892 3892 98.2480 1 2224 1 chr5D.!!$F1 2223
2 TraesCS5D01G458500 chr5D 329151189 329153414 2225 False 3849 3849 97.8900 1 2224 1 chr5D.!!$F2 2223
3 TraesCS5D01G458500 chr5D 6262243 6265504 3261 False 2597 3557 98.6685 1 2224 2 chr5D.!!$F3 2223
4 TraesCS5D01G458500 chr3B 101907483 101909709 2226 False 3976 3976 98.9220 1 2224 1 chr3B.!!$F1 2223
5 TraesCS5D01G458500 chr1D 254445477 254447699 2222 True 3923 3923 98.5180 1 2224 1 chr1D.!!$R1 2223
6 TraesCS5D01G458500 chr1D 51859371 51861597 2226 False 3827 3827 97.7100 1 2224 1 chr1D.!!$F1 2223
7 TraesCS5D01G458500 chr4D 19878928 19881121 2193 True 3699 3699 97.0880 29 2224 1 chr4D.!!$R1 2195
8 TraesCS5D01G458500 chr4D 206989030 206989846 816 False 1362 1362 96.7070 567 1386 1 chr4D.!!$F1 819
9 TraesCS5D01G458500 chr4A 309477658 309479290 1632 False 2754 2754 97.1240 1 1632 1 chr4A.!!$F1 1631
10 TraesCS5D01G458500 chr1B 427648840 427649981 1141 True 1762 1762 94.4980 984 2127 1 chr1B.!!$R1 1143
11 TraesCS5D01G458500 chrUn 439345744 439346595 851 True 1506 1506 98.5920 1374 2224 1 chrUn.!!$R1 850

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
829 1867 1.134759 GGCTCTTCCTCTAACCGGTTC 60.135 57.143 26.16 4.82 0.0 3.62 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1964 3002 3.491267 GCGAGGGAAAGATCATTTCTACG 59.509 47.826 13.68 15.14 33.05 3.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
330 1368 5.173854 GTCCAAAGATTCTTTCGCAAAACAG 59.826 40.000 8.71 0.00 0.00 3.16
829 1867 1.134759 GGCTCTTCCTCTAACCGGTTC 60.135 57.143 26.16 4.82 0.00 3.62
1291 2329 4.451900 CCATGTCTTCCGGCTACTTTATT 58.548 43.478 0.00 0.00 0.00 1.40
1463 2501 4.095782 CCAAATATGGCCCGTAATAATCCG 59.904 45.833 0.00 0.00 40.58 4.18
1464 2502 2.389962 TATGGCCCGTAATAATCCGC 57.610 50.000 0.00 0.00 0.00 5.54
1902 2940 4.813027 AGTATTTTTGTTAGAGCGACGGA 58.187 39.130 0.00 0.00 0.00 4.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
199 202 3.312697 GGGTAGAATTTGTGGATTCTCGC 59.687 47.826 3.60 2.40 43.44 5.03
330 1368 5.414765 ACCGATAAACCAGAAAAAGATGGAC 59.585 40.000 0.00 0.00 39.02 4.02
1291 2329 4.642885 AGAAACGTGAAATCAAAGTTGGGA 59.357 37.500 0.00 0.00 32.14 4.37
1422 2460 0.961753 GGCCTTGAGGTTTCCACTTG 59.038 55.000 0.00 0.00 37.57 3.16
1463 2501 3.232213 TCATCTTATATCGCGGAAGGC 57.768 47.619 6.13 0.00 38.69 4.35
1464 2502 4.500837 CGAATCATCTTATATCGCGGAAGG 59.499 45.833 6.13 0.00 0.00 3.46
1739 2777 5.076873 GCTTATATGCCATGGGAAGGTTAA 58.923 41.667 11.10 5.34 0.00 2.01
1964 3002 3.491267 GCGAGGGAAAGATCATTTCTACG 59.509 47.826 13.68 15.14 33.05 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.