Multiple sequence alignment - TraesCS5D01G458200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G458200 chr5D 100.000 2111 0 0 1 2111 503287049 503289159 0 3899
1 TraesCS5D01G458200 chr5D 97.398 2114 33 12 1 2111 6181197 6179103 0 3579
2 TraesCS5D01G458200 chr5D 97.206 2112 37 14 1 2111 120799621 120801711 0 3554
3 TraesCS5D01G458200 chr5D 95.837 2114 59 15 1 2111 167071683 167073770 0 3389
4 TraesCS5D01G458200 chr5D 98.633 1536 13 6 503 2036 512409297 512407768 0 2713
5 TraesCS5D01G458200 chr5D 98.623 1452 11 8 503 1950 512416234 512414788 0 2562
6 TraesCS5D01G458200 chr6D 97.823 2113 29 12 1 2111 45511822 45509725 0 3631
7 TraesCS5D01G458200 chr1D 97.681 2113 25 12 1 2111 254416814 254418904 0 3609
8 TraesCS5D01G458200 chr1D 97.350 2113 41 11 1 2111 51878324 51876225 0 3578
9 TraesCS5D01G458200 chr1D 95.513 1560 59 9 1 1559 260891856 260893405 0 2483
10 TraesCS5D01G458200 chr4A 95.360 2112 67 14 1 2111 309507385 309505304 0 3328
11 TraesCS5D01G458200 chr4A 96.171 1149 38 5 2 1150 310730849 310729707 0 1873


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G458200 chr5D 503287049 503289159 2110 False 3899 3899 100.000 1 2111 1 chr5D.!!$F3 2110
1 TraesCS5D01G458200 chr5D 6179103 6181197 2094 True 3579 3579 97.398 1 2111 1 chr5D.!!$R1 2110
2 TraesCS5D01G458200 chr5D 120799621 120801711 2090 False 3554 3554 97.206 1 2111 1 chr5D.!!$F1 2110
3 TraesCS5D01G458200 chr5D 167071683 167073770 2087 False 3389 3389 95.837 1 2111 1 chr5D.!!$F2 2110
4 TraesCS5D01G458200 chr5D 512407768 512409297 1529 True 2713 2713 98.633 503 2036 1 chr5D.!!$R2 1533
5 TraesCS5D01G458200 chr5D 512414788 512416234 1446 True 2562 2562 98.623 503 1950 1 chr5D.!!$R3 1447
6 TraesCS5D01G458200 chr6D 45509725 45511822 2097 True 3631 3631 97.823 1 2111 1 chr6D.!!$R1 2110
7 TraesCS5D01G458200 chr1D 254416814 254418904 2090 False 3609 3609 97.681 1 2111 1 chr1D.!!$F1 2110
8 TraesCS5D01G458200 chr1D 51876225 51878324 2099 True 3578 3578 97.350 1 2111 1 chr1D.!!$R1 2110
9 TraesCS5D01G458200 chr1D 260891856 260893405 1549 False 2483 2483 95.513 1 1559 1 chr1D.!!$F2 1558
10 TraesCS5D01G458200 chr4A 309505304 309507385 2081 True 3328 3328 95.360 1 2111 1 chr4A.!!$R1 2110
11 TraesCS5D01G458200 chr4A 310729707 310730849 1142 True 1873 1873 96.171 2 1150 1 chr4A.!!$R2 1148

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
834 840 4.019141 CACAATACCTAACCACCTAACCCA 60.019 45.833 0.0 0.0 0.0 4.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1871 1891 5.048364 TCCAATTTTATGTGTAGCGCAAAGT 60.048 36.0 11.47 0.0 0.0 2.66 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
104 105 8.318876 GCGACACTAATAAACACTAGTATGTTG 58.681 37.037 0.00 0.0 42.01 3.33
307 309 5.843969 AGGAGGTATTTTGTGTTTGGGAAAT 59.156 36.000 0.00 0.0 0.00 2.17
834 840 4.019141 CACAATACCTAACCACCTAACCCA 60.019 45.833 0.00 0.0 0.00 4.51
1118 1128 3.062234 GGACGCGAGGAGTAAAAATTCAG 59.938 47.826 15.93 0.0 0.00 3.02
1640 1659 4.400529 TCAAGAAAGCAAAAAGGGTTCC 57.599 40.909 0.00 0.0 0.00 3.62
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
27 28 1.175983 TAAGGCAGCGGGTTTTGGTG 61.176 55.000 0.00 0.00 37.86 4.17
104 105 9.781834 TGAAATGGTATTGACGAATAACAAATC 57.218 29.630 0.00 2.49 43.48 2.17
470 473 4.877282 TCGGGTAATTTGGCAAAGAAAAG 58.123 39.130 18.61 8.05 0.00 2.27
574 579 2.742053 TCATCGAAAACTTACAGCAGCC 59.258 45.455 0.00 0.00 0.00 4.85
1278 1291 1.055849 TGGCTGAGTGGACTAAAGCA 58.944 50.000 13.28 1.48 37.44 3.91
1871 1891 5.048364 TCCAATTTTATGTGTAGCGCAAAGT 60.048 36.000 11.47 0.00 0.00 2.66


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.