Multiple sequence alignment - TraesCS5D01G458100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G458100 chr5D 100.000 2195 0 0 1 2195 503286450 503288644 0 4054
1 TraesCS5D01G458100 chr5D 97.771 2198 35 13 1 2195 120799020 120801206 0 3775
2 TraesCS5D01G458100 chr5D 97.635 2199 29 14 1 2195 6181794 6179615 0 3751
3 TraesCS5D01G458100 chr5D 96.450 2197 62 9 1 2194 167071083 167073266 0 3611
4 TraesCS5D01G458100 chr5D 98.814 1096 7 5 1102 2195 512416234 512415143 0 1947
5 TraesCS5D01G458100 chr5D 98.813 1095 8 4 1102 2195 512409297 512408207 0 1945
6 TraesCS5D01G458100 chr1D 97.998 2198 24 10 1 2195 254416214 254418394 0 3797
7 TraesCS5D01G458100 chr1D 97.407 2198 44 10 1 2195 51878922 51876735 0 3731
8 TraesCS5D01G458100 chr1D 95.831 2159 79 9 1 2158 260891257 260893405 0 3478
9 TraesCS5D01G458100 chr6D 97.771 2198 28 12 1 2195 45512414 45510235 0 3768
10 TraesCS5D01G458100 chr4A 96.286 1750 52 10 1 1749 310731444 310729707 0 2859
11 TraesCS5D01G458100 chr2A 97.691 1646 28 8 1 1644 335831478 335829841 0 2820
12 TraesCS5D01G458100 chr5A 91.250 960 60 12 1097 2045 520661594 520662540 0 1286


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G458100 chr5D 503286450 503288644 2194 False 4054 4054 100.000 1 2195 1 chr5D.!!$F3 2194
1 TraesCS5D01G458100 chr5D 120799020 120801206 2186 False 3775 3775 97.771 1 2195 1 chr5D.!!$F1 2194
2 TraesCS5D01G458100 chr5D 6179615 6181794 2179 True 3751 3751 97.635 1 2195 1 chr5D.!!$R1 2194
3 TraesCS5D01G458100 chr5D 167071083 167073266 2183 False 3611 3611 96.450 1 2194 1 chr5D.!!$F2 2193
4 TraesCS5D01G458100 chr5D 512415143 512416234 1091 True 1947 1947 98.814 1102 2195 1 chr5D.!!$R3 1093
5 TraesCS5D01G458100 chr5D 512408207 512409297 1090 True 1945 1945 98.813 1102 2195 1 chr5D.!!$R2 1093
6 TraesCS5D01G458100 chr1D 254416214 254418394 2180 False 3797 3797 97.998 1 2195 1 chr1D.!!$F1 2194
7 TraesCS5D01G458100 chr1D 51876735 51878922 2187 True 3731 3731 97.407 1 2195 1 chr1D.!!$R1 2194
8 TraesCS5D01G458100 chr1D 260891257 260893405 2148 False 3478 3478 95.831 1 2158 1 chr1D.!!$F2 2157
9 TraesCS5D01G458100 chr6D 45510235 45512414 2179 True 3768 3768 97.771 1 2195 1 chr6D.!!$R1 2194
10 TraesCS5D01G458100 chr4A 310729707 310731444 1737 True 2859 2859 96.286 1 1749 1 chr4A.!!$R1 1748
11 TraesCS5D01G458100 chr2A 335829841 335831478 1637 True 2820 2820 97.691 1 1644 1 chr2A.!!$R1 1643
12 TraesCS5D01G458100 chr5A 520661594 520662540 946 False 1286 1286 91.250 1097 2045 1 chr5A.!!$F1 948

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
906 912 5.843969 AGGAGGTATTTTGTGTTTGGGAAAT 59.156 36.0 0.0 0.0 0.0 2.17 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1877 1904 1.055849 TGGCTGAGTGGACTAAAGCA 58.944 50.0 13.28 1.48 37.44 3.91 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
417 421 9.862371 AAGTGATTTTATAGTAGAGGCATATCG 57.138 33.333 0.00 0.0 0.00 2.92
552 556 7.945033 TTAATAAACTTTTGTCTCGTACGGT 57.055 32.000 16.52 0.0 0.00 4.83
703 707 8.318876 GCGACACTAATAAACACTAGTATGTTG 58.681 37.037 0.00 0.0 42.01 3.33
906 912 5.843969 AGGAGGTATTTTGTGTTTGGGAAAT 59.156 36.000 0.00 0.0 0.00 2.17
1433 1448 4.019141 CACAATACCTAACCACCTAACCCA 60.019 45.833 0.00 0.0 0.00 4.51
1717 1736 3.062234 GGACGCGAGGAGTAAAAATTCAG 59.938 47.826 15.93 0.0 0.00 3.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
417 421 4.454678 TGGGATCTATCAAGCACATTCAC 58.545 43.478 0.00 0.00 0.00 3.18
626 630 1.175983 TAAGGCAGCGGGTTTTGGTG 61.176 55.000 0.00 0.00 37.86 4.17
703 707 9.781834 TGAAATGGTATTGACGAATAACAAATC 57.218 29.630 0.00 2.49 43.48 2.17
1069 1076 4.877282 TCGGGTAATTTGGCAAAGAAAAG 58.123 39.130 18.61 8.05 0.00 2.27
1173 1184 2.742053 TCATCGAAAACTTACAGCAGCC 59.258 45.455 0.00 0.00 0.00 4.85
1877 1904 1.055849 TGGCTGAGTGGACTAAAGCA 58.944 50.000 13.28 1.48 37.44 3.91


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.