Multiple sequence alignment - TraesCS5D01G458000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G458000 chr5D 100.000 2498 0 0 1 2498 503277585 503280082 0 4614
1 TraesCS5D01G458000 chr5D 98.519 2499 36 1 1 2498 6189581 6187083 0 4409
2 TraesCS5D01G458000 chr5D 97.600 2500 55 5 1 2498 432402856 432405352 0 4279
3 TraesCS5D01G458000 chr5D 98.947 2090 21 1 1 2089 503218859 503216770 0 3736
4 TraesCS5D01G458000 chr3D 98.599 2499 31 3 1 2498 589278903 589281398 0 4418
5 TraesCS5D01G458000 chr1D 98.240 2500 42 2 1 2498 254397468 254399967 0 4372
6 TraesCS5D01G458000 chr5A 97.479 2499 59 4 1 2496 607275041 607272544 0 4263
7 TraesCS5D01G458000 chr4A 96.132 2508 85 9 1 2498 309515771 309513266 0 4084
8 TraesCS5D01G458000 chr4B 96.162 2501 79 7 1 2498 308697111 308694625 0 4071
9 TraesCS5D01G458000 chr6D 98.900 2091 21 2 1 2089 168255567 168253477 0 3733
10 TraesCS5D01G458000 chrUn 98.804 2091 22 3 1 2089 93408990 93411079 0 3720
11 TraesCS5D01G458000 chrUn 98.328 658 11 0 1841 2498 239345464 239346121 0 1155
12 TraesCS5D01G458000 chr7B 88.153 785 70 13 1721 2498 719442377 719441609 0 913


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G458000 chr5D 503277585 503280082 2497 False 4614 4614 100.000 1 2498 1 chr5D.!!$F2 2497
1 TraesCS5D01G458000 chr5D 6187083 6189581 2498 True 4409 4409 98.519 1 2498 1 chr5D.!!$R1 2497
2 TraesCS5D01G458000 chr5D 432402856 432405352 2496 False 4279 4279 97.600 1 2498 1 chr5D.!!$F1 2497
3 TraesCS5D01G458000 chr5D 503216770 503218859 2089 True 3736 3736 98.947 1 2089 1 chr5D.!!$R2 2088
4 TraesCS5D01G458000 chr3D 589278903 589281398 2495 False 4418 4418 98.599 1 2498 1 chr3D.!!$F1 2497
5 TraesCS5D01G458000 chr1D 254397468 254399967 2499 False 4372 4372 98.240 1 2498 1 chr1D.!!$F1 2497
6 TraesCS5D01G458000 chr5A 607272544 607275041 2497 True 4263 4263 97.479 1 2496 1 chr5A.!!$R1 2495
7 TraesCS5D01G458000 chr4A 309513266 309515771 2505 True 4084 4084 96.132 1 2498 1 chr4A.!!$R1 2497
8 TraesCS5D01G458000 chr4B 308694625 308697111 2486 True 4071 4071 96.162 1 2498 1 chr4B.!!$R1 2497
9 TraesCS5D01G458000 chr6D 168253477 168255567 2090 True 3733 3733 98.900 1 2089 1 chr6D.!!$R1 2088
10 TraesCS5D01G458000 chrUn 93408990 93411079 2089 False 3720 3720 98.804 1 2089 1 chrUn.!!$F1 2088
11 TraesCS5D01G458000 chrUn 239345464 239346121 657 False 1155 1155 98.328 1841 2498 1 chrUn.!!$F2 657
12 TraesCS5D01G458000 chr7B 719441609 719442377 768 True 913 913 88.153 1721 2498 1 chr7B.!!$R1 777

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
636 639 1.06406 GTTTGAAGCACGCACAGAACT 59.936 47.619 0.0 0.0 0.0 3.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1575 1584 0.892814 TTGTGAATCCACCATGCGCA 60.893 50.0 14.96 14.96 42.53 6.09 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
476 479 4.741342 ACGACGAAACCTAGAAATCGATT 58.259 39.130 4.39 4.39 38.59 3.34
636 639 1.064060 GTTTGAAGCACGCACAGAACT 59.936 47.619 0.00 0.00 0.00 3.01
1040 1043 2.394632 ACAGTTTGGGAAGGGGTTTTC 58.605 47.619 0.00 0.00 0.00 2.29
1209 1213 6.410853 CCACTTTAAGATTACCATCTGGGGAT 60.411 42.308 0.00 0.00 39.00 3.85
1214 1218 2.278657 TTACCATCTGGGGATGTCCA 57.721 50.000 0.54 0.00 45.66 4.02
1575 1584 1.804601 GAACGACGGGAATTGAACCT 58.195 50.000 0.00 0.00 0.00 3.50
1624 1634 3.118112 CCTTGATCCACTTGGCTACATCT 60.118 47.826 0.00 0.00 34.44 2.90
1642 1652 2.706350 TCTGCCCCTTATCCAGCTAAT 58.294 47.619 0.00 0.00 0.00 1.73
1813 1827 7.039923 AGCTCATCATTTATTGGCAAAGATAGG 60.040 37.037 3.01 0.00 0.00 2.57
1887 1901 5.614308 CATCTAGCATTCTACCCACAATGA 58.386 41.667 0.00 0.00 32.56 2.57
2286 2302 5.036117 AGGTTAGCACGGTTGATGATATT 57.964 39.130 0.00 0.00 0.00 1.28
2325 2343 3.181499 ACGCGACCTTGACTATCAACTAG 60.181 47.826 15.93 0.00 32.21 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
157 158 0.400525 CCTCCCCCTCTATGCCTTGA 60.401 60.000 0.00 0.00 0.00 3.02
476 479 7.201794 CGTAGAGGTAGTCAAATTGGATCAGTA 60.202 40.741 0.00 0.00 0.00 2.74
636 639 1.901464 GAAACAAGGGGCGCTTCCA 60.901 57.895 14.52 0.00 36.21 3.53
1040 1043 9.703892 TTGAAGTAGATTCTTCTTTTCTCTCAG 57.296 33.333 6.96 0.00 42.76 3.35
1214 1218 6.889722 TGCTAAGCAGTTTTGGGATACTAAAT 59.110 34.615 0.00 0.00 39.36 1.40
1575 1584 0.892814 TTGTGAATCCACCATGCGCA 60.893 50.000 14.96 14.96 42.53 6.09
1624 1634 2.957402 CATTAGCTGGATAAGGGGCA 57.043 50.000 0.00 0.00 0.00 5.36
1813 1827 6.240549 TCTCCTCCTTCATATTGACCTTTC 57.759 41.667 0.00 0.00 0.00 2.62
1887 1901 1.896220 ATCGCGATTGTATGGCCAAT 58.104 45.000 17.62 0.00 37.74 3.16
2207 2223 4.594675 ACTTCCCTCTAGACTTAGCTGA 57.405 45.455 0.00 0.00 0.00 4.26
2286 2302 4.984161 GTCGCGTTATTAATACTTGGGCTA 59.016 41.667 5.77 0.00 0.00 3.93


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.