Multiple sequence alignment - TraesCS5D01G457900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G457900 chr5D 100.000 3101 0 0 1 3101 503279976 503276876 0.000000e+00 5727
1 TraesCS5D01G457900 chr5D 98.485 3102 46 1 1 3101 6187189 6190290 0.000000e+00 5467
2 TraesCS5D01G457900 chr5D 97.454 3103 74 5 1 3101 432405246 432402147 0.000000e+00 5288
3 TraesCS5D01G457900 chr5D 98.892 2799 30 1 304 3101 503216770 503219568 0.000000e+00 4996
4 TraesCS5D01G457900 chr3D 98.549 3102 40 4 1 3101 589281292 589278195 0.000000e+00 5474
5 TraesCS5D01G457900 chr1D 98.260 3103 51 3 1 3101 254399861 254396760 0.000000e+00 5428
6 TraesCS5D01G457900 chr5A 97.294 3104 79 5 1 3101 607272648 607275749 0.000000e+00 5262
7 TraesCS5D01G457900 chr2A 96.971 3103 72 5 1 3101 335836897 335839979 0.000000e+00 5190
8 TraesCS5D01G457900 chr4B 96.457 3105 92 8 1 3101 308694731 308697821 0.000000e+00 5108
9 TraesCS5D01G457900 chr4A 96.368 3111 101 9 1 3101 309513372 309516480 0.000000e+00 5108
10 TraesCS5D01G457900 chr6D 98.786 2800 32 2 304 3101 168253477 168256276 0.000000e+00 4981
11 TraesCS5D01G457900 chrUn 98.750 2800 31 4 304 3101 93411079 93408282 0.000000e+00 4974
12 TraesCS5D01G457900 chrUn 98.370 552 9 0 1 552 239346015 239345464 0.000000e+00 970
13 TraesCS5D01G457900 chr7D 96.575 146 5 0 224 369 204018550 204018405 3.090000e-60 243


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G457900 chr5D 503276876 503279976 3100 True 5727 5727 100.000 1 3101 1 chr5D.!!$R2 3100
1 TraesCS5D01G457900 chr5D 6187189 6190290 3101 False 5467 5467 98.485 1 3101 1 chr5D.!!$F1 3100
2 TraesCS5D01G457900 chr5D 432402147 432405246 3099 True 5288 5288 97.454 1 3101 1 chr5D.!!$R1 3100
3 TraesCS5D01G457900 chr5D 503216770 503219568 2798 False 4996 4996 98.892 304 3101 1 chr5D.!!$F2 2797
4 TraesCS5D01G457900 chr3D 589278195 589281292 3097 True 5474 5474 98.549 1 3101 1 chr3D.!!$R1 3100
5 TraesCS5D01G457900 chr1D 254396760 254399861 3101 True 5428 5428 98.260 1 3101 1 chr1D.!!$R1 3100
6 TraesCS5D01G457900 chr5A 607272648 607275749 3101 False 5262 5262 97.294 1 3101 1 chr5A.!!$F1 3100
7 TraesCS5D01G457900 chr2A 335836897 335839979 3082 False 5190 5190 96.971 1 3101 1 chr2A.!!$F1 3100
8 TraesCS5D01G457900 chr4B 308694731 308697821 3090 False 5108 5108 96.457 1 3101 1 chr4B.!!$F1 3100
9 TraesCS5D01G457900 chr4A 309513372 309516480 3108 False 5108 5108 96.368 1 3101 1 chr4A.!!$F1 3100
10 TraesCS5D01G457900 chr6D 168253477 168256276 2799 False 4981 4981 98.786 304 3101 1 chr6D.!!$F1 2797
11 TraesCS5D01G457900 chrUn 93408282 93411079 2797 True 4974 4974 98.750 304 3101 1 chrUn.!!$R1 2797
12 TraesCS5D01G457900 chrUn 239345464 239346015 551 True 970 970 98.370 1 552 1 chrUn.!!$R2 551

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
816 853 0.892814 TTGTGAATCCACCATGCGCA 60.893 50.000 14.96 14.96 42.53 6.09 F
1177 1219 6.889722 TGCTAAGCAGTTTTGGGATACTAAAT 59.110 34.615 0.00 0.00 39.36 1.40 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1755 1800 1.06406 GTTTGAAGCACGCACAGAACT 59.936 47.619 0.0 0.0 0.00 3.01 R
2517 2565 2.40805 GTAGCTGTGAATAGCCATCGG 58.592 52.381 0.0 0.0 44.76 4.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
105 112 4.984161 GTCGCGTTATTAATACTTGGGCTA 59.016 41.667 5.77 0.00 0.00 3.93
184 191 4.594675 ACTTCCCTCTAGACTTAGCTGA 57.405 45.455 0.00 0.00 0.00 4.26
504 513 1.896220 ATCGCGATTGTATGGCCAAT 58.104 45.000 17.62 0.00 37.74 3.16
578 611 6.240549 TCTCCTCCTTCATATTGACCTTTC 57.759 41.667 0.00 0.00 0.00 2.62
767 804 2.957402 CATTAGCTGGATAAGGGGCA 57.043 50.000 0.00 0.00 0.00 5.36
816 853 0.892814 TTGTGAATCCACCATGCGCA 60.893 50.000 14.96 14.96 42.53 6.09
1177 1219 6.889722 TGCTAAGCAGTTTTGGGATACTAAAT 59.110 34.615 0.00 0.00 39.36 1.40
1351 1394 9.703892 TTGAAGTAGATTCTTCTTTTCTCTCAG 57.296 33.333 6.96 0.00 42.76 3.35
1755 1800 1.901464 GAAACAAGGGGCGCTTCCA 60.901 57.895 14.52 0.00 36.21 3.53
1915 1960 7.201794 CGTAGAGGTAGTCAAATTGGATCAGTA 60.202 40.741 0.00 0.00 0.00 2.74
2234 2281 0.400525 CCTCCCCCTCTATGCCTTGA 60.401 60.000 0.00 0.00 0.00 3.02
2479 2527 4.513442 ACGTCTGTAATGCATTGTATGGT 58.487 39.130 22.27 9.65 0.00 3.55
2932 2981 1.667236 TCAGCCATGGATGCTTAACG 58.333 50.000 25.40 0.00 36.81 3.18
2957 3006 7.039882 GGGGATCATCGTACATCGTAAATAAT 58.960 38.462 0.00 0.00 40.80 1.28
3069 3118 5.454471 CCTCTCTGGATCCTCGAATTGAAAT 60.454 44.000 14.23 0.00 38.35 2.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
66 73 3.181499 ACGCGACCTTGACTATCAACTAG 60.181 47.826 15.93 0.00 32.21 2.57
105 112 5.036117 AGGTTAGCACGGTTGATGATATT 57.964 39.130 0.00 0.00 0.00 1.28
504 513 5.614308 CATCTAGCATTCTACCCACAATGA 58.386 41.667 0.00 0.00 32.56 2.57
578 611 7.039923 AGCTCATCATTTATTGGCAAAGATAGG 60.040 37.037 3.01 0.00 0.00 2.57
749 786 2.706350 TCTGCCCCTTATCCAGCTAAT 58.294 47.619 0.00 0.00 0.00 1.73
767 804 3.118112 CCTTGATCCACTTGGCTACATCT 60.118 47.826 0.00 0.00 34.44 2.90
816 853 1.804601 GAACGACGGGAATTGAACCT 58.195 50.000 0.00 0.00 0.00 3.50
1177 1219 2.278657 TTACCATCTGGGGATGTCCA 57.721 50.000 0.54 0.00 45.66 4.02
1182 1224 6.410853 CCACTTTAAGATTACCATCTGGGGAT 60.411 42.308 0.00 0.00 39.00 3.85
1351 1394 2.394632 ACAGTTTGGGAAGGGGTTTTC 58.605 47.619 0.00 0.00 0.00 2.29
1755 1800 1.064060 GTTTGAAGCACGCACAGAACT 59.936 47.619 0.00 0.00 0.00 3.01
1915 1960 4.741342 ACGACGAAACCTAGAAATCGATT 58.259 39.130 4.39 4.39 38.59 3.34
2517 2565 2.408050 GTAGCTGTGAATAGCCATCGG 58.592 52.381 0.00 0.00 44.76 4.18
2932 2981 3.928727 TTACGATGTACGATGATCCCC 57.071 47.619 0.00 0.00 45.77 4.81
3069 3118 7.537596 GATTCTTGATCCCTCTCAATCTCTA 57.462 40.000 0.00 0.00 34.76 2.43


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.