Multiple sequence alignment - TraesCS5D01G457700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G457700 chr5D 100.000 2570 0 0 1 2570 503277728 503275159 0.000000e+00 4747
1 TraesCS5D01G457700 chr5D 98.782 2299 27 1 1 2299 503218716 503221013 0.000000e+00 4089
2 TraesCS5D01G457700 chr5D 98.217 2299 40 1 1 2299 6189438 6191735 0.000000e+00 4017
3 TraesCS5D01G457700 chr5D 100.000 277 0 0 2294 2570 503221656 503221932 1.760000e-141 512
4 TraesCS5D01G457700 chr1A 98.913 2299 24 1 1 2299 554512746 554515043 0.000000e+00 4106
5 TraesCS5D01G457700 chr1A 98.917 277 3 0 2294 2570 554515688 554515964 1.780000e-136 496
6 TraesCS5D01G457700 chr3B 98.695 2299 29 1 1 2299 201527522 201529819 0.000000e+00 4078
7 TraesCS5D01G457700 chr3B 99.278 277 2 0 2294 2570 101914616 101914892 3.820000e-138 501
8 TraesCS5D01G457700 chr3B 99.278 277 2 0 2294 2570 201530464 201530740 3.820000e-138 501
9 TraesCS5D01G457700 chr6D 98.521 2299 33 1 1 2299 168255424 168257721 0.000000e+00 4056
10 TraesCS5D01G457700 chr6D 98.917 277 3 0 2294 2570 168261106 168261382 1.780000e-136 496
11 TraesCS5D01G457700 chr1D 98.391 2299 33 4 1 2299 254397611 254395317 0.000000e+00 4037
12 TraesCS5D01G457700 chr3A 98.347 2299 34 4 1 2299 672909509 672907215 0.000000e+00 4032
13 TraesCS5D01G457700 chr3A 98.173 2299 39 3 1 2299 594899126 594896831 0.000000e+00 4010
14 TraesCS5D01G457700 chr3A 99.278 277 2 0 2294 2570 66014185 66013909 3.820000e-138 501
15 TraesCS5D01G457700 chrUn 98.301 2296 37 2 4 2299 216518101 216515808 0.000000e+00 4023
16 TraesCS5D01G457700 chrUn 99.278 277 2 0 2294 2570 441244265 441244541 3.820000e-138 501
17 TraesCS5D01G457700 chr7D 99.278 277 2 0 2294 2570 231575643 231575919 3.820000e-138 501
18 TraesCS5D01G457700 chr5A 99.278 277 2 0 2294 2570 510137056 510136780 3.820000e-138 501


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G457700 chr5D 503275159 503277728 2569 True 4747.0 4747 100.0000 1 2570 1 chr5D.!!$R1 2569
1 TraesCS5D01G457700 chr5D 6189438 6191735 2297 False 4017.0 4017 98.2170 1 2299 1 chr5D.!!$F1 2298
2 TraesCS5D01G457700 chr5D 503218716 503221932 3216 False 2300.5 4089 99.3910 1 2570 2 chr5D.!!$F2 2569
3 TraesCS5D01G457700 chr1A 554512746 554515964 3218 False 2301.0 4106 98.9150 1 2570 2 chr1A.!!$F1 2569
4 TraesCS5D01G457700 chr3B 201527522 201530740 3218 False 2289.5 4078 98.9865 1 2570 2 chr3B.!!$F2 2569
5 TraesCS5D01G457700 chr6D 168255424 168261382 5958 False 2276.0 4056 98.7190 1 2570 2 chr6D.!!$F1 2569
6 TraesCS5D01G457700 chr1D 254395317 254397611 2294 True 4037.0 4037 98.3910 1 2299 1 chr1D.!!$R1 2298
7 TraesCS5D01G457700 chr3A 672907215 672909509 2294 True 4032.0 4032 98.3470 1 2299 1 chr3A.!!$R3 2298
8 TraesCS5D01G457700 chr3A 594896831 594899126 2295 True 4010.0 4010 98.1730 1 2299 1 chr3A.!!$R2 2298
9 TraesCS5D01G457700 chrUn 216515808 216518101 2293 True 4023.0 4023 98.3010 4 2299 1 chrUn.!!$R1 2295

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
684 686 1.667236 TCAGCCATGGATGCTTAACG 58.333 50.0 25.4 0.0 36.81 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1616 1621 2.888414 CCAAAGAAAAACCCGCTTCCTA 59.112 45.455 0.0 0.0 0.0 2.94 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
231 233 4.513442 ACGTCTGTAATGCATTGTATGGT 58.487 39.130 22.27 9.65 0.00 3.55
684 686 1.667236 TCAGCCATGGATGCTTAACG 58.333 50.000 25.40 0.00 36.81 3.18
709 711 7.039882 GGGGATCATCGTACATCGTAAATAAT 58.960 38.462 0.00 0.00 40.80 1.28
821 823 5.454471 CCTCTCTGGATCCTCGAATTGAAAT 60.454 44.000 14.23 0.00 38.35 2.17
995 997 4.339247 CCTAGTTGGCATTGATAACAAGGG 59.661 45.833 0.00 0.00 39.46 3.95
1616 1621 7.865706 ATAAAGATAAAGAGGCAATCGTGTT 57.134 32.000 0.00 0.00 0.00 3.32
1860 1865 1.837439 TCTGGTGCAATCCTTACCGAT 59.163 47.619 0.00 0.00 37.29 4.18
1875 1880 6.882140 TCCTTACCGATAGAAAAAGATTGCAA 59.118 34.615 0.00 0.00 39.76 4.08
1880 1885 6.599244 ACCGATAGAAAAAGATTGCAATCAGA 59.401 34.615 34.59 15.46 36.54 3.27
2147 2152 1.407656 AAAGATATCCGCGGAGGCCA 61.408 55.000 33.87 18.19 40.77 5.36
2273 2278 6.778069 TGTCTATTCTCTAATTCACCCGATCT 59.222 38.462 0.00 0.00 0.00 2.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
269 271 2.408050 GTAGCTGTGAATAGCCATCGG 58.592 52.381 0.00 0.00 44.76 4.18
684 686 3.928727 TTACGATGTACGATGATCCCC 57.071 47.619 0.00 0.00 45.77 4.81
762 764 5.471456 GTCATCTCCGAATATTTGCCATCTT 59.529 40.000 0.00 0.00 0.00 2.40
821 823 7.537596 GATTCTTGATCCCTCTCAATCTCTA 57.462 40.000 0.00 0.00 34.76 2.43
1616 1621 2.888414 CCAAAGAAAAACCCGCTTCCTA 59.112 45.455 0.00 0.00 0.00 2.94
1652 1657 3.476552 TCTTCATGCTCGTTCCAAGTTT 58.523 40.909 0.00 0.00 0.00 2.66
1875 1880 8.171164 TGTCACTCGACTATTATCAATCTGAT 57.829 34.615 0.00 0.00 43.06 2.90
2147 2152 4.985538 ATCAGAATAGGACGAACGAACT 57.014 40.909 0.14 1.39 0.00 3.01
2273 2278 4.998672 CAGTTCCAAAAACGGGTACTATCA 59.001 41.667 0.00 0.00 34.70 2.15


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.