Multiple sequence alignment - TraesCS5D01G457500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G457500 chr5D 100.000 2471 0 0 1 2471 503270104 503272574 0 4564
1 TraesCS5D01G457500 chr5D 99.312 2471 16 1 1 2471 503226440 503223971 0 4468
2 TraesCS5D01G457500 chr5D 98.908 2473 24 2 1 2471 503236757 503234286 0 4414
3 TraesCS5D01G457500 chr3A 99.110 2471 20 2 1 2471 66009401 66011869 0 4440
4 TraesCS5D01G457500 chrUn 98.584 2471 32 3 1 2471 216510386 216512853 0 4366
5 TraesCS5D01G457500 chrUn 98.584 2471 32 3 1 2471 286272997 286270530 0 4366
6 TraesCS5D01G457500 chr3B 98.544 2473 33 2 1 2471 201535251 201532780 0 4364
7 TraesCS5D01G457500 chr1D 98.424 2474 35 2 1 2471 254386864 254389336 0 4349
8 TraesCS5D01G457500 chr1B 98.260 2471 38 5 1 2471 633745677 633748142 0 4320


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G457500 chr5D 503270104 503272574 2470 False 4564 4564 100.000 1 2471 1 chr5D.!!$F1 2470
1 TraesCS5D01G457500 chr5D 503223971 503226440 2469 True 4468 4468 99.312 1 2471 1 chr5D.!!$R1 2470
2 TraesCS5D01G457500 chr5D 503234286 503236757 2471 True 4414 4414 98.908 1 2471 1 chr5D.!!$R2 2470
3 TraesCS5D01G457500 chr3A 66009401 66011869 2468 False 4440 4440 99.110 1 2471 1 chr3A.!!$F1 2470
4 TraesCS5D01G457500 chrUn 216510386 216512853 2467 False 4366 4366 98.584 1 2471 1 chrUn.!!$F1 2470
5 TraesCS5D01G457500 chrUn 286270530 286272997 2467 True 4366 4366 98.584 1 2471 1 chrUn.!!$R1 2470
6 TraesCS5D01G457500 chr3B 201532780 201535251 2471 True 4364 4364 98.544 1 2471 1 chr3B.!!$R1 2470
7 TraesCS5D01G457500 chr1D 254386864 254389336 2472 False 4349 4349 98.424 1 2471 1 chr1D.!!$F1 2470
8 TraesCS5D01G457500 chr1B 633745677 633748142 2465 False 4320 4320 98.260 1 2471 1 chr1B.!!$F1 2470

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
348 349 0.461961 GAACCCTAGATGCTGTCGCT 59.538 55.0 0.0 0.0 36.97 4.93 F
637 638 7.198306 ACAATTCGAAATACCTCGACTTTTT 57.802 32.0 0.0 0.0 46.95 1.94 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1284 1288 1.293498 GGCGAGTGCTCTTCCTTGA 59.707 57.895 0.0 0.0 42.25 3.02 R
1868 1872 6.323739 GGCCAAAAATTAGGATACATTCTGGA 59.676 38.462 0.0 0.0 41.41 3.86 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
179 180 3.306472 AAAACCCAACTCTGCCTTACA 57.694 42.857 0.00 0.00 0.00 2.41
223 224 8.655935 ATTAACCTCTGGATTTGAAATCACTT 57.344 30.769 18.55 4.01 0.00 3.16
348 349 0.461961 GAACCCTAGATGCTGTCGCT 59.538 55.000 0.00 0.00 36.97 4.93
637 638 7.198306 ACAATTCGAAATACCTCGACTTTTT 57.802 32.000 0.00 0.00 46.95 1.94
1284 1288 9.853177 AAAGTTCCGATTGAAATAGGATCTAAT 57.147 29.630 13.10 6.17 38.48 1.73
1299 1303 5.070313 AGGATCTAATCAAGGAAGAGCACTC 59.930 44.000 0.00 0.00 0.00 3.51
1442 1446 2.363680 CGACTCATAGAATGGCAGAGGT 59.636 50.000 0.00 0.00 0.00 3.85
2269 2273 8.786826 TTCAGTTTATGTTCCTACCTATTGTG 57.213 34.615 0.00 0.00 0.00 3.33
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
179 180 6.537660 GGTTAATCGTACTCTGGCAACTTTAT 59.462 38.462 0.00 0.00 37.61 1.40
223 224 8.688222 TTATGGCCAATACCAGGTATATAAGA 57.312 34.615 10.96 0.00 44.71 2.10
348 349 3.500680 GCCCTTGTTGACGATTCTTTACA 59.499 43.478 0.00 0.00 0.00 2.41
637 638 1.699730 TGACTCGGACCTGTTCTGAA 58.300 50.000 0.00 0.00 39.28 3.02
1284 1288 1.293498 GGCGAGTGCTCTTCCTTGA 59.707 57.895 0.00 0.00 42.25 3.02
1442 1446 6.371548 ACGAAAATGTGCAAGAGCTCTATTTA 59.628 34.615 18.59 3.34 42.74 1.40
1868 1872 6.323739 GGCCAAAAATTAGGATACATTCTGGA 59.676 38.462 0.00 0.00 41.41 3.86


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.