Multiple sequence alignment - TraesCS5D01G457300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G457300 chr5D 100.000 2273 0 0 1 2273 503258795 503256523 0 4198
1 TraesCS5D01G457300 chr7B 98.286 2276 35 4 1 2273 622431988 622429714 0 3984
2 TraesCS5D01G457300 chr7B 98.215 1625 28 1 1 1624 662732894 662734518 0 2839
3 TraesCS5D01G457300 chr7B 96.148 623 9 5 1653 2273 71816219 71816828 0 1003
4 TraesCS5D01G457300 chr6B 98.241 2274 35 4 1 2273 515380591 515378322 0 3973
5 TraesCS5D01G457300 chr3B 97.980 2277 39 5 1 2273 201549282 201551555 0 3943
6 TraesCS5D01G457300 chr3B 97.908 1625 33 1 1 1624 201565401 201563777 0 2811
7 TraesCS5D01G457300 chr2D 98.022 2275 29 7 1 2273 591991654 591993914 0 3938
8 TraesCS5D01G457300 chrUn 97.264 1974 24 8 303 2273 331843654 331841708 0 3319
9 TraesCS5D01G457300 chrUn 97.310 1859 19 5 418 2273 354744415 354742585 0 3127
10 TraesCS5D01G457300 chr3D 97.968 1673 18 6 603 2273 158942640 158940982 0 2887
11 TraesCS5D01G457300 chr3D 98.057 1441 13 5 835 2273 589253354 589251927 0 2492
12 TraesCS5D01G457300 chr2A 98.277 1625 27 1 1 1624 543187641 543189265 0 2844
13 TraesCS5D01G457300 chr1D 98.092 1625 29 2 1 1624 254531578 254533201 0 2828
14 TraesCS5D01G457300 chr3A 97.908 1625 33 1 1 1624 695636380 695638004 0 2811
15 TraesCS5D01G457300 chr3A 97.846 1625 32 3 1 1624 672883048 672881426 0 2804
16 TraesCS5D01G457300 chr4A 96.364 495 12 4 1779 2273 310772156 310771668 0 809


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G457300 chr5D 503256523 503258795 2272 True 4198 4198 100.000 1 2273 1 chr5D.!!$R1 2272
1 TraesCS5D01G457300 chr7B 622429714 622431988 2274 True 3984 3984 98.286 1 2273 1 chr7B.!!$R1 2272
2 TraesCS5D01G457300 chr7B 662732894 662734518 1624 False 2839 2839 98.215 1 1624 1 chr7B.!!$F2 1623
3 TraesCS5D01G457300 chr7B 71816219 71816828 609 False 1003 1003 96.148 1653 2273 1 chr7B.!!$F1 620
4 TraesCS5D01G457300 chr6B 515378322 515380591 2269 True 3973 3973 98.241 1 2273 1 chr6B.!!$R1 2272
5 TraesCS5D01G457300 chr3B 201549282 201551555 2273 False 3943 3943 97.980 1 2273 1 chr3B.!!$F1 2272
6 TraesCS5D01G457300 chr3B 201563777 201565401 1624 True 2811 2811 97.908 1 1624 1 chr3B.!!$R1 1623
7 TraesCS5D01G457300 chr2D 591991654 591993914 2260 False 3938 3938 98.022 1 2273 1 chr2D.!!$F1 2272
8 TraesCS5D01G457300 chrUn 331841708 331843654 1946 True 3319 3319 97.264 303 2273 1 chrUn.!!$R1 1970
9 TraesCS5D01G457300 chrUn 354742585 354744415 1830 True 3127 3127 97.310 418 2273 1 chrUn.!!$R2 1855
10 TraesCS5D01G457300 chr3D 158940982 158942640 1658 True 2887 2887 97.968 603 2273 1 chr3D.!!$R1 1670
11 TraesCS5D01G457300 chr3D 589251927 589253354 1427 True 2492 2492 98.057 835 2273 1 chr3D.!!$R2 1438
12 TraesCS5D01G457300 chr2A 543187641 543189265 1624 False 2844 2844 98.277 1 1624 1 chr2A.!!$F1 1623
13 TraesCS5D01G457300 chr1D 254531578 254533201 1623 False 2828 2828 98.092 1 1624 1 chr1D.!!$F1 1623
14 TraesCS5D01G457300 chr3A 695636380 695638004 1624 False 2811 2811 97.908 1 1624 1 chr3A.!!$F1 1623
15 TraesCS5D01G457300 chr3A 672881426 672883048 1622 True 2804 2804 97.846 1 1624 1 chr3A.!!$R1 1623

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
481 482 6.6335 AACTCTGGACAATTTCGAAATCAA 57.367 33.333 22.93 5.44 0.0 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2026 2048 6.672266 TCTTCTATGGATCCGCTTATTCTT 57.328 37.5 7.39 0.0 0.0 2.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
197 198 7.148086 TGCAATAGCTATTTTCGAACCATTTCT 60.148 33.333 16.46 0.00 42.74 2.52
383 384 6.909357 CCGTAGAGAATTGAGAATTTTCATGC 59.091 38.462 0.00 0.00 35.18 4.06
481 482 6.633500 AACTCTGGACAATTTCGAAATCAA 57.367 33.333 22.93 5.44 0.00 2.57
611 612 9.832445 AATCGTTTCAGTATGTTAAGGATACAT 57.168 29.630 7.13 0.00 36.30 2.29
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
383 384 7.391786 CAATTACGAGTACGAGAATTGAAAGG 58.608 38.462 18.99 3.77 46.07 3.11
481 482 4.452455 GCATATGTATTAAGACGCTTGGCT 59.548 41.667 4.29 0.00 0.00 4.75
1920 1929 8.703604 ATATACAGTTGGTCATATAATCGTGC 57.296 34.615 0.00 0.00 0.00 5.34
2026 2048 6.672266 TCTTCTATGGATCCGCTTATTCTT 57.328 37.500 7.39 0.00 0.00 2.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.