Multiple sequence alignment - TraesCS5D01G456800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G456800 chr5D 100.000 2354 0 0 1 2354 503222514 503220161 0.000000e+00 4348
1 TraesCS5D01G456800 chr3B 98.941 2360 16 4 1 2354 101915474 101913118 0.000000e+00 4211
2 TraesCS5D01G456800 chr3B 98.432 2359 29 3 1 2354 201531322 201528967 0.000000e+00 4145
3 TraesCS5D01G456800 chr3B 96.166 939 35 1 1416 2354 700784416 700785353 0.000000e+00 1533
4 TraesCS5D01G456800 chr3B 96.179 602 16 2 984 1580 392551793 392551194 0.000000e+00 977
5 TraesCS5D01G456800 chr3B 97.096 551 8 1 1 551 6002020 6001478 0.000000e+00 922
6 TraesCS5D01G456800 chr3B 96.867 383 12 0 509 891 687579623 687579241 1.970000e-180 641
7 TraesCS5D01G456800 chrUn 98.811 2354 26 1 1 2354 216514309 216516660 0.000000e+00 4191
8 TraesCS5D01G456800 chr3D 98.811 2354 25 2 1 2354 589272662 589275012 0.000000e+00 4189
9 TraesCS5D01G456800 chr1A 98.643 2359 24 3 1 2354 554516546 554514191 0.000000e+00 4172
10 TraesCS5D01G456800 chr1D 98.556 2354 31 2 1 2354 254393818 254396168 0.000000e+00 4156
11 TraesCS5D01G456800 chr3A 98.343 2354 34 4 1 2354 672905718 672908066 0.000000e+00 4126
12 TraesCS5D01G456800 chr3A 98.258 2354 37 3 1 2354 594895333 594897682 0.000000e+00 4117


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G456800 chr5D 503220161 503222514 2353 True 4348 4348 100.000 1 2354 1 chr5D.!!$R1 2353
1 TraesCS5D01G456800 chr3B 101913118 101915474 2356 True 4211 4211 98.941 1 2354 1 chr3B.!!$R2 2353
2 TraesCS5D01G456800 chr3B 201528967 201531322 2355 True 4145 4145 98.432 1 2354 1 chr3B.!!$R3 2353
3 TraesCS5D01G456800 chr3B 700784416 700785353 937 False 1533 1533 96.166 1416 2354 1 chr3B.!!$F1 938
4 TraesCS5D01G456800 chr3B 392551194 392551793 599 True 977 977 96.179 984 1580 1 chr3B.!!$R4 596
5 TraesCS5D01G456800 chr3B 6001478 6002020 542 True 922 922 97.096 1 551 1 chr3B.!!$R1 550
6 TraesCS5D01G456800 chrUn 216514309 216516660 2351 False 4191 4191 98.811 1 2354 1 chrUn.!!$F1 2353
7 TraesCS5D01G456800 chr3D 589272662 589275012 2350 False 4189 4189 98.811 1 2354 1 chr3D.!!$F1 2353
8 TraesCS5D01G456800 chr1A 554514191 554516546 2355 True 4172 4172 98.643 1 2354 1 chr1A.!!$R1 2353
9 TraesCS5D01G456800 chr1D 254393818 254396168 2350 False 4156 4156 98.556 1 2354 1 chr1D.!!$F1 2353
10 TraesCS5D01G456800 chr3A 672905718 672908066 2348 False 4126 4126 98.343 1 2354 1 chr3A.!!$F2 2353
11 TraesCS5D01G456800 chr3A 594895333 594897682 2349 False 4117 4117 98.258 1 2354 1 chr3A.!!$F1 2353

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
760 761 6.952358 AGGCATAATATGGAGAATGCTCATTT 59.048 34.615 2.29 0.0 43.33 2.32 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1771 1784 1.073923 AGGGAACGGAATGCTCAAACT 59.926 47.619 0.0 0.0 0.0 2.66 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
395 396 9.326489 ACCTGCTTTTGACATATCTATCCTATA 57.674 33.333 0.00 0.00 0.00 1.31
760 761 6.952358 AGGCATAATATGGAGAATGCTCATTT 59.048 34.615 2.29 0.00 43.33 2.32
930 931 7.052142 TCCCTCGAAGGAGATAATAAAGAAC 57.948 40.000 0.00 0.00 43.27 3.01
1209 1222 4.144297 CCAACTTGGATTTGGTTCTCTCA 58.856 43.478 0.92 0.00 40.96 3.27
1268 1281 7.410120 AAAGCAAGATCCCGAATAAGAAAAT 57.590 32.000 0.00 0.00 0.00 1.82
1569 1582 0.673644 AGAGGTCCGTTGGCATTTCG 60.674 55.000 0.00 0.00 0.00 3.46
1720 1733 2.803593 ATTGTCCCAAGGGCGCCATT 62.804 55.000 30.85 26.91 34.68 3.16
1771 1784 1.919240 TCGTTCCTCTAGCAGTTCCA 58.081 50.000 0.00 0.00 0.00 3.53
1878 1892 9.965824 TTCAAAACATTTCTAACAGATTCCTTC 57.034 29.630 0.00 0.00 0.00 3.46
2108 2123 4.531332 CGCCAGAAAAACTCAAAAGAGAG 58.469 43.478 0.00 0.00 41.44 3.20
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
49 50 0.906775 AGCAATTGCAAGAATGGGGG 59.093 50.000 30.89 0.0 45.16 5.40
352 353 4.716784 AGCAGGTCTGATTACACCTATTCA 59.283 41.667 1.65 0.0 0.00 2.57
395 396 5.137551 GGTGCATATGGTACCCAAATAAGT 58.862 41.667 10.07 0.0 45.69 2.24
760 761 3.709653 ACTTCTACGGGGAATGCTCATTA 59.290 43.478 0.00 0.0 0.00 1.90
790 791 4.809496 AGCGCCAGGCCCAGATTG 62.809 66.667 5.63 0.0 45.17 2.67
930 931 3.392616 AGTAGGATACCATCTGCTTTGGG 59.607 47.826 5.37 0.0 44.47 4.12
1209 1222 0.163788 CTGCAACTCGCGATTTTCGT 59.836 50.000 10.36 0.0 46.97 3.85
1268 1281 3.260128 GGTTTCCTCTTCCTCGGTTTCTA 59.740 47.826 0.00 0.0 0.00 2.10
1311 1324 5.444122 CAAAGAATGACAAAAGACGAGACC 58.556 41.667 0.00 0.0 0.00 3.85
1720 1733 3.523564 AGCATAACTTGGGCTCCTAGAAA 59.476 43.478 9.06 0.0 30.74 2.52
1771 1784 1.073923 AGGGAACGGAATGCTCAAACT 59.926 47.619 0.00 0.0 0.00 2.66
1878 1892 2.320805 TTACTTCGTCGGTCTGAACG 57.679 50.000 9.20 9.2 0.00 3.95
2108 2123 6.198216 GCATGAAGAGATTAACGAGACTTCTC 59.802 42.308 0.00 0.0 39.55 2.87


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.