Multiple sequence alignment - TraesCS5D01G456700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G456700 chr5D 100.000 2414 0 0 1 2414 503217741 503215328 0 4458
1 TraesCS5D01G456700 chr5D 97.978 2324 36 8 95 2414 329120677 329122993 0 4021
2 TraesCS5D01G456700 chrUn 99.214 2417 14 5 1 2414 93410108 93412522 0 4353
3 TraesCS5D01G456700 chr2D 99.048 2417 17 6 1 2414 272794370 272796783 0 4331
4 TraesCS5D01G456700 chr6D 98.634 2416 25 5 1 2414 168251061 168248652 0 4272
5 TraesCS5D01G456700 chr3A 97.932 2418 42 7 1 2414 672910484 672912897 0 4181
6 TraesCS5D01G456700 chr6A 97.603 2420 46 9 1 2414 260116757 260119170 0 4137
7 TraesCS5D01G456700 chr7A 95.199 2416 104 8 1 2414 352182290 352184695 0 3808
8 TraesCS5D01G456700 chr2A 97.963 1767 32 4 577 2342 335829841 335828078 0 3061
9 TraesCS5D01G456700 chr1D 96.040 1717 54 12 702 2412 397109208 397110916 0 2782
10 TraesCS5D01G456700 chr5A 97.495 1397 32 3 3 1397 619265892 619264497 0 2383


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G456700 chr5D 503215328 503217741 2413 True 4458 4458 100.000 1 2414 1 chr5D.!!$R1 2413
1 TraesCS5D01G456700 chr5D 329120677 329122993 2316 False 4021 4021 97.978 95 2414 1 chr5D.!!$F1 2319
2 TraesCS5D01G456700 chrUn 93410108 93412522 2414 False 4353 4353 99.214 1 2414 1 chrUn.!!$F1 2413
3 TraesCS5D01G456700 chr2D 272794370 272796783 2413 False 4331 4331 99.048 1 2414 1 chr2D.!!$F1 2413
4 TraesCS5D01G456700 chr6D 168248652 168251061 2409 True 4272 4272 98.634 1 2414 1 chr6D.!!$R1 2413
5 TraesCS5D01G456700 chr3A 672910484 672912897 2413 False 4181 4181 97.932 1 2414 1 chr3A.!!$F1 2413
6 TraesCS5D01G456700 chr6A 260116757 260119170 2413 False 4137 4137 97.603 1 2414 1 chr6A.!!$F1 2413
7 TraesCS5D01G456700 chr7A 352182290 352184695 2405 False 3808 3808 95.199 1 2414 1 chr7A.!!$F1 2413
8 TraesCS5D01G456700 chr2A 335828078 335829841 1763 True 3061 3061 97.963 577 2342 1 chr2A.!!$R1 1765
9 TraesCS5D01G456700 chr1D 397109208 397110916 1708 False 2782 2782 96.040 702 2412 1 chr1D.!!$F1 1710
10 TraesCS5D01G456700 chr5A 619264497 619265892 1395 True 2383 2383 97.495 3 1397 1 chr5A.!!$R1 1394

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
18 19 3.111405 GGGGTGGGCAATTAGCTAC 57.889 57.895 0.0 0.0 44.79 3.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2112 2136 2.98605 TGTTTGGAGGGGAAGTCTACT 58.014 47.619 0.0 0.0 0.0 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
18 19 3.111405 GGGGTGGGCAATTAGCTAC 57.889 57.895 0.0 0.0 44.79 3.58
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
555 559 8.480133 AAGTACGGAGGTCAGAATAAATAGAT 57.520 34.615 0.0 0.0 0.00 1.98
2111 2135 3.323775 TGTTTGGAGGGGAAGTCTACTT 58.676 45.455 0.0 0.0 39.23 2.24
2112 2136 2.986050 TGTTTGGAGGGGAAGTCTACT 58.014 47.619 0.0 0.0 0.00 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.