Multiple sequence alignment - TraesCS5D01G456500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G456500 chr5D 100.000 2372 0 0 1 2372 503214804 503212433 0 4381
1 TraesCS5D01G456500 chr5D 97.633 2408 18 8 1 2372 560881398 560878994 0 4095
2 TraesCS5D01G456500 chrUn 97.551 2409 21 6 1 2372 93415415 93417822 0 4087
3 TraesCS5D01G456500 chrUn 99.167 1081 9 0 1 1081 93413047 93414127 0 1947
4 TraesCS5D01G456500 chrUn 98.359 792 6 3 1586 2372 327660563 327661352 0 1384
5 TraesCS5D01G456500 chr2D 97.214 2405 28 9 1 2372 272797308 272799706 0 4034
6 TraesCS5D01G456500 chr2D 99.111 1238 10 1 1 1237 635585967 635587204 0 2224
7 TraesCS5D01G456500 chr3B 96.636 2408 35 11 1 2372 201523596 201521199 0 3956
8 TraesCS5D01G456500 chr6D 96.672 2404 21 11 1 2371 168248125 168245748 0 3941
9 TraesCS5D01G456500 chr3A 96.091 2405 41 11 1 2372 672913421 672915805 0 3871
10 TraesCS5D01G456500 chr6A 96.045 2402 48 9 1 2372 271186359 271183975 0 3866
11 TraesCS5D01G456500 chr1D 98.158 1574 23 4 1 1570 254522655 254521084 0 2741
12 TraesCS5D01G456500 chr1D 96.659 1287 11 4 1118 2372 144238516 144237230 0 2109
13 TraesCS5D01G456500 chr3D 98.923 1393 13 2 1 1392 24168397 24167006 0 2488
14 TraesCS5D01G456500 chr4A 95.223 1277 25 15 1126 2372 722779092 722780362 0 1988
15 TraesCS5D01G456500 chr7A 94.893 1077 12 8 1333 2372 201366794 201367864 0 1644
16 TraesCS5D01G456500 chr4D 90.465 881 71 9 719 1595 349797059 349797930 0 1149


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G456500 chr5D 503212433 503214804 2371 True 4381 4381 100.000 1 2372 1 chr5D.!!$R1 2371
1 TraesCS5D01G456500 chr5D 560878994 560881398 2404 True 4095 4095 97.633 1 2372 1 chr5D.!!$R2 2371
2 TraesCS5D01G456500 chrUn 93413047 93417822 4775 False 3017 4087 98.359 1 2372 2 chrUn.!!$F2 2371
3 TraesCS5D01G456500 chrUn 327660563 327661352 789 False 1384 1384 98.359 1586 2372 1 chrUn.!!$F1 786
4 TraesCS5D01G456500 chr2D 272797308 272799706 2398 False 4034 4034 97.214 1 2372 1 chr2D.!!$F1 2371
5 TraesCS5D01G456500 chr2D 635585967 635587204 1237 False 2224 2224 99.111 1 1237 1 chr2D.!!$F2 1236
6 TraesCS5D01G456500 chr3B 201521199 201523596 2397 True 3956 3956 96.636 1 2372 1 chr3B.!!$R1 2371
7 TraesCS5D01G456500 chr6D 168245748 168248125 2377 True 3941 3941 96.672 1 2371 1 chr6D.!!$R1 2370
8 TraesCS5D01G456500 chr3A 672913421 672915805 2384 False 3871 3871 96.091 1 2372 1 chr3A.!!$F1 2371
9 TraesCS5D01G456500 chr6A 271183975 271186359 2384 True 3866 3866 96.045 1 2372 1 chr6A.!!$R1 2371
10 TraesCS5D01G456500 chr1D 254521084 254522655 1571 True 2741 2741 98.158 1 1570 1 chr1D.!!$R2 1569
11 TraesCS5D01G456500 chr1D 144237230 144238516 1286 True 2109 2109 96.659 1118 2372 1 chr1D.!!$R1 1254
12 TraesCS5D01G456500 chr3D 24167006 24168397 1391 True 2488 2488 98.923 1 1392 1 chr3D.!!$R1 1391
13 TraesCS5D01G456500 chr4A 722779092 722780362 1270 False 1988 1988 95.223 1126 2372 1 chr4A.!!$F1 1246
14 TraesCS5D01G456500 chr7A 201366794 201367864 1070 False 1644 1644 94.893 1333 2372 1 chr7A.!!$F1 1039
15 TraesCS5D01G456500 chr4D 349797059 349797930 871 False 1149 1149 90.465 719 1595 1 chr4D.!!$F1 876

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
636 3011 2.939103 GCAGGACGAAGAGCAATAACAT 59.061 45.455 0.0 0.0 0.0 2.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2039 4477 2.044353 ACATTCCATTGGGTAGGGCTTT 59.956 45.455 2.09 0.0 34.93 3.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
636 3011 2.939103 GCAGGACGAAGAGCAATAACAT 59.061 45.455 0.0 0.00 0.00 2.71
669 3044 4.885325 GTCGTGGTGGAAAAATATGGGTAT 59.115 41.667 0.0 0.00 0.00 2.73
783 3158 8.931385 TGTTAAACCTGGTCGTATACTTTATC 57.069 34.615 0.0 0.00 0.00 1.75
1164 3550 2.659428 CCCCAAATGCCTCTAGAAAGG 58.341 52.381 0.0 0.00 39.62 3.11
1267 3653 6.147864 ACAATGCTGCGGTTATAATTGATT 57.852 33.333 11.9 0.00 0.00 2.57
2039 4477 7.623268 GTAACTTTCGAAGGTTTAGTTACGA 57.377 36.000 27.6 7.34 40.40 3.43
2193 4631 3.689161 CGTTATGATTCAAGCAAGGGACA 59.311 43.478 0.0 0.00 0.00 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
636 3011 0.459411 CCACCACGACGTGCATATCA 60.459 55.000 22.46 0.0 32.10 2.15
669 3044 3.533547 CCGGTTTGTCGGGAAATATACA 58.466 45.455 0.00 0.0 45.78 2.29
835 3210 5.883115 TGACTTCGTATGGGCATTTTATTGA 59.117 36.000 0.00 0.0 0.00 2.57
838 3213 6.959639 ATTGACTTCGTATGGGCATTTTAT 57.040 33.333 0.00 0.0 0.00 1.40
1338 3724 9.301897 ACTTCAGGAGCTAATGAAACTATTTTT 57.698 29.630 12.67 0.0 35.14 1.94
1993 4431 3.982576 TTTGCTTCTCTCGGGTTTTTC 57.017 42.857 0.00 0.0 0.00 2.29
2039 4477 2.044353 ACATTCCATTGGGTAGGGCTTT 59.956 45.455 2.09 0.0 34.93 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.