Multiple sequence alignment - TraesCS5D01G456400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G456400 chr5D 100.000 2386 0 0 1 2386 503214298 503211913 0.000000e+00 4407
1 TraesCS5D01G456400 chr5D 97.360 2424 22 15 1 2386 560880892 560878473 0.000000e+00 4084
2 TraesCS5D01G456400 chrUn 97.483 2424 21 8 1 2386 93415922 93418343 0.000000e+00 4102
3 TraesCS5D01G456400 chrUn 98.479 1315 10 5 1080 2386 327660563 327661875 0.000000e+00 2309
4 TraesCS5D01G456400 chrUn 98.594 640 9 0 55 694 425406646 425407285 0.000000e+00 1133
5 TraesCS5D01G456400 chr2D 97.234 2422 28 8 1 2386 272797811 272800229 0.000000e+00 4065
6 TraesCS5D01G456400 chr2D 98.769 731 9 0 1 731 635586474 635587204 0.000000e+00 1301
7 TraesCS5D01G456400 chr2D 100.000 68 0 0 1 68 166021721 166021654 2.490000e-25 126
8 TraesCS5D01G456400 chr3B 96.451 2423 36 14 1 2386 201523090 201520681 0.000000e+00 3952
9 TraesCS5D01G456400 chr6A 96.152 2417 42 13 1 2386 271185853 271183457 0.000000e+00 3901
10 TraesCS5D01G456400 chr3A 96.033 2420 40 14 1 2386 672913926 672916323 0.000000e+00 3886
11 TraesCS5D01G456400 chr6D 96.046 1897 17 10 1 1865 168247618 168245748 0.000000e+00 3035
12 TraesCS5D01G456400 chr1D 97.236 1809 15 7 612 2386 144238516 144236709 0.000000e+00 3031
13 TraesCS5D01G456400 chr1D 97.844 1067 19 2 1 1064 254522149 254521084 0.000000e+00 1840
14 TraesCS5D01G456400 chr4A 96.107 1798 33 16 620 2386 722779092 722780883 0.000000e+00 2898
15 TraesCS5D01G456400 chr3D 98.533 886 12 1 1 886 24167890 24167006 0.000000e+00 1563
16 TraesCS5D01G456400 chr4D 90.465 881 71 9 213 1089 349797059 349797930 0.000000e+00 1149
17 TraesCS5D01G456400 chr2A 98.684 76 1 0 1 76 540249109 540249184 4.140000e-28 135


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G456400 chr5D 503211913 503214298 2385 True 4407 4407 100.000 1 2386 1 chr5D.!!$R1 2385
1 TraesCS5D01G456400 chr5D 560878473 560880892 2419 True 4084 4084 97.360 1 2386 1 chr5D.!!$R2 2385
2 TraesCS5D01G456400 chrUn 93415922 93418343 2421 False 4102 4102 97.483 1 2386 1 chrUn.!!$F1 2385
3 TraesCS5D01G456400 chrUn 327660563 327661875 1312 False 2309 2309 98.479 1080 2386 1 chrUn.!!$F2 1306
4 TraesCS5D01G456400 chrUn 425406646 425407285 639 False 1133 1133 98.594 55 694 1 chrUn.!!$F3 639
5 TraesCS5D01G456400 chr2D 272797811 272800229 2418 False 4065 4065 97.234 1 2386 1 chr2D.!!$F1 2385
6 TraesCS5D01G456400 chr2D 635586474 635587204 730 False 1301 1301 98.769 1 731 1 chr2D.!!$F2 730
7 TraesCS5D01G456400 chr3B 201520681 201523090 2409 True 3952 3952 96.451 1 2386 1 chr3B.!!$R1 2385
8 TraesCS5D01G456400 chr6A 271183457 271185853 2396 True 3901 3901 96.152 1 2386 1 chr6A.!!$R1 2385
9 TraesCS5D01G456400 chr3A 672913926 672916323 2397 False 3886 3886 96.033 1 2386 1 chr3A.!!$F1 2385
10 TraesCS5D01G456400 chr6D 168245748 168247618 1870 True 3035 3035 96.046 1 1865 1 chr6D.!!$R1 1864
11 TraesCS5D01G456400 chr1D 144236709 144238516 1807 True 3031 3031 97.236 612 2386 1 chr1D.!!$R1 1774
12 TraesCS5D01G456400 chr1D 254521084 254522149 1065 True 1840 1840 97.844 1 1064 1 chr1D.!!$R2 1063
13 TraesCS5D01G456400 chr4A 722779092 722780883 1791 False 2898 2898 96.107 620 2386 1 chr4A.!!$F1 1766
14 TraesCS5D01G456400 chr3D 24167006 24167890 884 True 1563 1563 98.533 1 886 1 chr3D.!!$R1 885
15 TraesCS5D01G456400 chr4D 349797059 349797930 871 False 1149 1149 90.465 213 1089 1 chr4D.!!$F1 876

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
658 669 2.659428 CCCCAAATGCCTCTAGAAAGG 58.341 52.381 0.0 0.0 39.62 3.11 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1533 1593 2.044353 ACATTCCATTGGGTAGGGCTTT 59.956 45.455 2.09 0.0 34.93 3.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
130 131 2.939103 GCAGGACGAAGAGCAATAACAT 59.061 45.455 0.0 0.00 0.00 2.71
163 164 4.885325 GTCGTGGTGGAAAAATATGGGTAT 59.115 41.667 0.0 0.00 0.00 2.73
277 278 8.931385 TGTTAAACCTGGTCGTATACTTTATC 57.069 34.615 0.0 0.00 0.00 1.75
658 669 2.659428 CCCCAAATGCCTCTAGAAAGG 58.341 52.381 0.0 0.00 39.62 3.11
761 772 6.147864 ACAATGCTGCGGTTATAATTGATT 57.852 33.333 11.9 0.00 0.00 2.57
1533 1593 7.623268 GTAACTTTCGAAGGTTTAGTTACGA 57.377 36.000 27.6 7.34 40.40 3.43
1687 1747 3.689161 CGTTATGATTCAAGCAAGGGACA 59.311 43.478 0.0 0.00 0.00 4.02
2153 2218 9.341078 GGTTTATTTTACCCTGAAACGGATATA 57.659 33.333 0.0 0.00 32.08 0.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
130 131 0.459411 CCACCACGACGTGCATATCA 60.459 55.000 22.46 0.0 32.10 2.15
163 164 3.533547 CCGGTTTGTCGGGAAATATACA 58.466 45.455 0.00 0.0 45.78 2.29
329 330 5.883115 TGACTTCGTATGGGCATTTTATTGA 59.117 36.000 0.00 0.0 0.00 2.57
332 333 6.959639 ATTGACTTCGTATGGGCATTTTAT 57.040 33.333 0.00 0.0 0.00 1.40
832 844 9.301897 ACTTCAGGAGCTAATGAAACTATTTTT 57.698 29.630 12.67 0.0 35.14 1.94
1487 1547 3.982576 TTTGCTTCTCTCGGGTTTTTC 57.017 42.857 0.00 0.0 0.00 2.29
1533 1593 2.044353 ACATTCCATTGGGTAGGGCTTT 59.956 45.455 2.09 0.0 34.93 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.