Multiple sequence alignment - TraesCS5D01G425100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G425100 chr5D 100.000 3431 0 0 1 3431 483803712 483800282 0.000000e+00 6336.0
1 TraesCS5D01G425100 chr5D 98.046 2763 30 7 1 2763 6220125 6217387 0.000000e+00 4782.0
2 TraesCS5D01G425100 chr5D 99.248 665 5 0 2767 3431 6213572 6214236 0.000000e+00 1201.0
3 TraesCS5D01G425100 chr5D 99.098 665 6 0 2767 3431 6213050 6212386 0.000000e+00 1195.0
4 TraesCS5D01G425100 chr5D 99.098 665 6 0 2767 3431 6216833 6216169 0.000000e+00 1195.0
5 TraesCS5D01G425100 chr2D 98.769 2763 22 4 1 2763 643857407 643860157 0.000000e+00 4903.0
6 TraesCS5D01G425100 chr2D 98.431 2613 24 6 1 2607 628292446 628289845 0.000000e+00 4582.0
7 TraesCS5D01G425100 chr2D 98.893 1084 5 3 1 1083 359630830 359629753 0.000000e+00 1929.0
8 TraesCS5D01G425100 chr2D 98.573 701 8 2 2064 2763 628289857 628289158 0.000000e+00 1238.0
9 TraesCS5D01G425100 chr2D 98.947 665 7 0 2767 3431 643860710 643861374 0.000000e+00 1190.0
10 TraesCS5D01G425100 chr1D 97.721 2764 39 7 1 2763 254481043 254483783 0.000000e+00 4734.0
11 TraesCS5D01G425100 chr1D 96.184 1913 63 4 805 2716 244392264 244394167 0.000000e+00 3120.0
12 TraesCS5D01G425100 chr1D 98.346 665 11 0 2767 3431 254484336 254485000 0.000000e+00 1168.0
13 TraesCS5D01G425100 chr1A 98.038 2650 34 7 70 2713 554474458 554471821 0.000000e+00 4590.0
14 TraesCS5D01G425100 chr1A 99.248 665 5 0 2767 3431 554470436 554469772 0.000000e+00 1201.0
15 TraesCS5D01G425100 chr3B 97.816 1740 30 3 1 1740 201497067 201498798 0.000000e+00 2996.0
16 TraesCS5D01G425100 chr3B 98.430 1529 16 3 1190 2713 201498791 201500316 0.000000e+00 2684.0
17 TraesCS5D01G425100 chr3B 96.967 989 23 3 1294 2282 544899265 544900246 0.000000e+00 1653.0
18 TraesCS5D01G425100 chr3B 98.797 665 8 0 2767 3431 201501172 201501836 0.000000e+00 1184.0
19 TraesCS5D01G425100 chr3B 90.909 154 14 0 1089 1242 240800073 240800226 1.250000e-49 207.0
20 TraesCS5D01G425100 chr2B 97.869 1126 17 2 1 1126 474938915 474940033 0.000000e+00 1940.0
21 TraesCS5D01G425100 chr3A 97.014 1105 30 1 1627 2731 393238698 393237597 0.000000e+00 1855.0
22 TraesCS5D01G425100 chr3A 100.000 30 0 0 2733 2762 393236553 393236524 4.780000e-04 56.5
23 TraesCS5D01G425100 chr4A 96.234 1062 27 8 1 1057 309271966 309270913 0.000000e+00 1727.0
24 TraesCS5D01G425100 chr6D 98.947 665 6 1 2767 3431 431396539 431395876 0.000000e+00 1188.0
25 TraesCS5D01G425100 chrUn 98.938 659 7 0 2767 3425 444442122 444442780 0.000000e+00 1179.0
26 TraesCS5D01G425100 chr2A 98.624 218 3 0 1063 1280 506688574 506688357 1.490000e-103 387.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G425100 chr5D 483800282 483803712 3430 True 6336.000000 6336 100.000000 1 3431 1 chr5D.!!$R1 3430
1 TraesCS5D01G425100 chr5D 6212386 6220125 7739 True 2390.666667 4782 98.747333 1 3431 3 chr5D.!!$R2 3430
2 TraesCS5D01G425100 chr5D 6213572 6214236 664 False 1201.000000 1201 99.248000 2767 3431 1 chr5D.!!$F1 664
3 TraesCS5D01G425100 chr2D 643857407 643861374 3967 False 3046.500000 4903 98.858000 1 3431 2 chr2D.!!$F1 3430
4 TraesCS5D01G425100 chr2D 628289158 628292446 3288 True 2910.000000 4582 98.502000 1 2763 2 chr2D.!!$R2 2762
5 TraesCS5D01G425100 chr2D 359629753 359630830 1077 True 1929.000000 1929 98.893000 1 1083 1 chr2D.!!$R1 1082
6 TraesCS5D01G425100 chr1D 244392264 244394167 1903 False 3120.000000 3120 96.184000 805 2716 1 chr1D.!!$F1 1911
7 TraesCS5D01G425100 chr1D 254481043 254485000 3957 False 2951.000000 4734 98.033500 1 3431 2 chr1D.!!$F2 3430
8 TraesCS5D01G425100 chr1A 554469772 554474458 4686 True 2895.500000 4590 98.643000 70 3431 2 chr1A.!!$R1 3361
9 TraesCS5D01G425100 chr3B 201497067 201501836 4769 False 2288.000000 2996 98.347667 1 3431 3 chr3B.!!$F3 3430
10 TraesCS5D01G425100 chr3B 544899265 544900246 981 False 1653.000000 1653 96.967000 1294 2282 1 chr3B.!!$F2 988
11 TraesCS5D01G425100 chr2B 474938915 474940033 1118 False 1940.000000 1940 97.869000 1 1126 1 chr2B.!!$F1 1125
12 TraesCS5D01G425100 chr3A 393236524 393238698 2174 True 955.750000 1855 98.507000 1627 2762 2 chr3A.!!$R1 1135
13 TraesCS5D01G425100 chr4A 309270913 309271966 1053 True 1727.000000 1727 96.234000 1 1057 1 chr4A.!!$R1 1056
14 TraesCS5D01G425100 chr6D 431395876 431396539 663 True 1188.000000 1188 98.947000 2767 3431 1 chr6D.!!$R1 664
15 TraesCS5D01G425100 chrUn 444442122 444442780 658 False 1179.000000 1179 98.938000 2767 3425 1 chrUn.!!$F1 658

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
119 120 1.355720 CCTGGGGGAAAAGTGACATCT 59.644 52.381 0.0 0.0 33.58 2.90 F
1580 1588 3.756963 AGAGCGTGTTATGAGTGTCTACA 59.243 43.478 0.0 0.0 0.00 2.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1856 2408 3.071874 TGTGAAGAAGTAGGCCATTGG 57.928 47.619 5.01 0.0 0.0 3.16 R
3293 10290 4.310769 CGCATAAGGAATCGAAGGAAGAT 58.689 43.478 0.00 0.0 0.0 2.40 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
119 120 1.355720 CCTGGGGGAAAAGTGACATCT 59.644 52.381 0.0 0.0 33.58 2.90
1390 1398 5.014202 ACGTATTTGGTTTCAAAGCCCTAT 58.986 37.500 0.0 0.0 44.87 2.57
1393 1401 6.094325 CGTATTTGGTTTCAAAGCCCTATGTA 59.906 38.462 0.0 0.0 44.87 2.29
1580 1588 3.756963 AGAGCGTGTTATGAGTGTCTACA 59.243 43.478 0.0 0.0 0.00 2.74
1856 2408 2.050985 GGCTCATTATTGCCGCGC 60.051 61.111 0.0 0.0 39.71 6.86
3012 10009 6.130692 AGGTTCTCGAAAAAGGGGTAATTA 57.869 37.500 0.0 0.0 0.00 1.40
3293 10290 1.002201 TCCCTGGAATAAAACGTCGCA 59.998 47.619 0.0 0.0 0.00 5.10
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
119 120 4.223556 TCAAATTATTGGACCCGTGCTA 57.776 40.909 0.00 0.0 37.15 3.49
641 647 6.096673 TCTTTGATAGATATAGCGCAACCA 57.903 37.500 11.47 0.0 0.00 3.67
1390 1398 4.597004 AGATCCTCCAAACGTAGAGTACA 58.403 43.478 8.76 0.0 0.00 2.90
1393 1401 3.626670 CGTAGATCCTCCAAACGTAGAGT 59.373 47.826 8.76 0.0 0.00 3.24
1580 1588 6.074648 TCTTTGGTAAAATCAAGTCCACCAT 58.925 36.000 0.00 0.0 36.05 3.55
1856 2408 3.071874 TGTGAAGAAGTAGGCCATTGG 57.928 47.619 5.01 0.0 0.00 3.16
2046 2598 7.164171 CGATCTTTTTCAATAAAATCATCGCGT 59.836 33.333 5.77 0.0 38.40 6.01
3012 10009 6.019108 AGAAAAAGAATACAGGCCCAGAAAT 58.981 36.000 0.00 0.0 0.00 2.17
3137 10134 4.508461 TTCCGTAGAAAGACATCACGAA 57.492 40.909 0.00 0.0 34.66 3.85
3293 10290 4.310769 CGCATAAGGAATCGAAGGAAGAT 58.689 43.478 0.00 0.0 0.00 2.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.