Multiple sequence alignment - TraesCS5D01G406000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G406000 chr5D 100.000 6130 0 0 1 6130 471043336 471049465 0.000000e+00 11321.0
1 TraesCS5D01G406000 chr5D 73.396 1278 249 66 3129 4376 470770299 470771515 5.760000e-105 392.0
2 TraesCS5D01G406000 chr5D 78.270 474 94 6 4453 4920 470771517 470771987 4.650000e-76 296.0
3 TraesCS5D01G406000 chr5A 99.029 5973 38 8 1 5956 591314620 591320589 0.000000e+00 10691.0
4 TraesCS5D01G406000 chr5A 73.763 1273 253 56 3129 4376 591154628 591155844 5.680000e-115 425.0
5 TraesCS5D01G406000 chr5A 98.077 52 1 0 5954 6005 591321256 591321307 2.350000e-14 91.6
6 TraesCS5D01G406000 chr5B 96.405 6203 134 32 1 6130 578363763 578369949 0.000000e+00 10137.0
7 TraesCS5D01G406000 chrUn 100.000 387 0 0 5242 5628 480431226 480431612 0.000000e+00 715.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G406000 chr5D 471043336 471049465 6129 False 11321.0 11321 100.000 1 6130 1 chr5D.!!$F1 6129
1 TraesCS5D01G406000 chr5D 470770299 470771987 1688 False 344.0 392 75.833 3129 4920 2 chr5D.!!$F2 1791
2 TraesCS5D01G406000 chr5A 591314620 591321307 6687 False 5391.3 10691 98.553 1 6005 2 chr5A.!!$F2 6004
3 TraesCS5D01G406000 chr5A 591154628 591155844 1216 False 425.0 425 73.763 3129 4376 1 chr5A.!!$F1 1247
4 TraesCS5D01G406000 chr5B 578363763 578369949 6186 False 10137.0 10137 96.405 1 6130 1 chr5B.!!$F1 6129

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
21 22 0.548510 CCAGATCCACTTCCCCTTCC 59.451 60.000 0.00 0.0 0.00 3.46 F
2936 2974 2.069273 GTCGCAGTGCATGTAGAACTT 58.931 47.619 16.83 0.0 32.01 2.66 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2936 2974 0.329261 ATGCACAGCTAAGGGAAGCA 59.671 50.0 0.0 0.0 45.3 3.91 R
5132 5189 0.252284 ACCGACCAGGATCAGAGGTT 60.252 55.0 0.0 0.0 45.0 3.50 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
21 22 0.548510 CCAGATCCACTTCCCCTTCC 59.451 60.000 0.00 0.00 0.00 3.46
2936 2974 2.069273 GTCGCAGTGCATGTAGAACTT 58.931 47.619 16.83 0.00 32.01 2.66
3811 3862 1.405661 GGAAGAGCTTGTAGAACGGGG 60.406 57.143 0.00 0.00 0.00 5.73
4989 5043 3.147629 GCTACCGTAGAGATAGAAGCCA 58.852 50.000 9.88 0.00 0.00 4.75
5132 5189 1.664649 CGCAGCTTCGTCCTGAACA 60.665 57.895 0.00 0.00 32.03 3.18
5240 5307 4.137879 CATACTCTGCTGGCCTGC 57.862 61.111 26.46 26.46 0.00 4.85
5905 5990 2.751166 TCCTCGCCTTCTCTCTTTTG 57.249 50.000 0.00 0.00 0.00 2.44
6034 6788 2.157738 CAGATTAGGCTTAGGGCATGC 58.842 52.381 9.90 9.90 44.01 4.06
6035 6789 1.074566 AGATTAGGCTTAGGGCATGCC 59.925 52.381 29.47 29.47 45.77 4.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
21 22 4.410400 GGCACGGAGGTGGGAAGG 62.410 72.222 0.00 0.00 44.54 3.46
2936 2974 0.329261 ATGCACAGCTAAGGGAAGCA 59.671 50.000 0.00 0.00 45.30 3.91
3811 3862 3.870633 AACTACCAACAGATCTCCGAC 57.129 47.619 0.00 0.00 0.00 4.79
3890 3941 0.664761 CTGTTGGGTCAGCACAAGTG 59.335 55.000 0.00 0.00 38.91 3.16
4790 4844 3.604582 CAAGATGTCCTTCTGGAAGTCC 58.395 50.000 9.15 0.00 45.18 3.85
5132 5189 0.252284 ACCGACCAGGATCAGAGGTT 60.252 55.000 0.00 0.00 45.00 3.50
5905 5990 6.086871 CGGAAATCCTCTCTTTTGCTAAAAC 58.913 40.000 0.00 0.00 0.00 2.43
6034 6788 0.679640 TGTAAGCGCTTCCCATTGGG 60.680 55.000 28.82 16.26 46.11 4.12
6035 6789 1.392589 ATGTAAGCGCTTCCCATTGG 58.607 50.000 28.82 0.00 0.00 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.