Multiple sequence alignment - TraesCS5D01G395100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G395100 chr5D 100.000 1876 0 0 428 2303 462907619 462909494 0.000000e+00 3465
1 TraesCS5D01G395100 chr5D 100.000 97 0 0 1 97 462907192 462907288 1.820000e-41 180
2 TraesCS5D01G395100 chr1D 95.996 1873 63 7 428 2292 235547820 235545952 0.000000e+00 3033
3 TraesCS5D01G395100 chr1D 96.875 96 1 2 4 97 235547923 235547828 2.370000e-35 159
4 TraesCS5D01G395100 chr1B 94.894 1880 64 19 428 2292 253825706 253823844 0.000000e+00 2911
5 TraesCS5D01G395100 chr1B 97.233 253 6 1 428 680 578103358 578103609 5.880000e-116 427
6 TraesCS5D01G395100 chr1B 93.939 99 4 2 1 97 253825812 253825714 5.130000e-32 148
7 TraesCS5D01G395100 chr7A 94.423 1847 86 13 458 2292 439030854 439032695 0.000000e+00 2824
8 TraesCS5D01G395100 chr2B 94.161 1627 81 8 678 2296 13184006 13185626 0.000000e+00 2466
9 TraesCS5D01G395100 chr3D 96.517 1493 38 9 450 1932 143483574 143482086 0.000000e+00 2457
10 TraesCS5D01G395100 chr2A 95.225 1445 60 5 862 2300 441110111 441111552 0.000000e+00 2278
11 TraesCS5D01G395100 chr7D 95.470 1435 48 7 865 2292 635929327 635927903 0.000000e+00 2274
12 TraesCS5D01G395100 chr7D 97.628 253 5 1 428 680 635929582 635929331 1.260000e-117 433
13 TraesCS5D01G395100 chr5B 94.784 1438 60 10 862 2292 89745418 89746847 0.000000e+00 2226
14 TraesCS5D01G395100 chr4A 94.521 1442 64 6 865 2298 281593802 281592368 0.000000e+00 2211
15 TraesCS5D01G395100 chr7B 94.433 1006 38 9 1297 2292 634824607 634825604 0.000000e+00 1531
16 TraesCS5D01G395100 chr7B 95.341 279 9 3 450 725 634824331 634824608 7.550000e-120 440
17 TraesCS5D01G395100 chr6D 94.111 934 44 7 1243 2175 298130733 298129810 0.000000e+00 1410
18 TraesCS5D01G395100 chr6D 96.255 801 26 3 450 1247 298140118 298139319 0.000000e+00 1310
19 TraesCS5D01G395100 chr3B 88.081 344 26 9 450 782 66954517 66954178 5.960000e-106 394


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G395100 chr5D 462907192 462909494 2302 False 1822.5 3465 100.0000 1 2303 2 chr5D.!!$F1 2302
1 TraesCS5D01G395100 chr1D 235545952 235547923 1971 True 1596.0 3033 96.4355 4 2292 2 chr1D.!!$R1 2288
2 TraesCS5D01G395100 chr1B 253823844 253825812 1968 True 1529.5 2911 94.4165 1 2292 2 chr1B.!!$R1 2291
3 TraesCS5D01G395100 chr7A 439030854 439032695 1841 False 2824.0 2824 94.4230 458 2292 1 chr7A.!!$F1 1834
4 TraesCS5D01G395100 chr2B 13184006 13185626 1620 False 2466.0 2466 94.1610 678 2296 1 chr2B.!!$F1 1618
5 TraesCS5D01G395100 chr3D 143482086 143483574 1488 True 2457.0 2457 96.5170 450 1932 1 chr3D.!!$R1 1482
6 TraesCS5D01G395100 chr2A 441110111 441111552 1441 False 2278.0 2278 95.2250 862 2300 1 chr2A.!!$F1 1438
7 TraesCS5D01G395100 chr7D 635927903 635929582 1679 True 1353.5 2274 96.5490 428 2292 2 chr7D.!!$R1 1864
8 TraesCS5D01G395100 chr5B 89745418 89746847 1429 False 2226.0 2226 94.7840 862 2292 1 chr5B.!!$F1 1430
9 TraesCS5D01G395100 chr4A 281592368 281593802 1434 True 2211.0 2211 94.5210 865 2298 1 chr4A.!!$R1 1433
10 TraesCS5D01G395100 chr7B 634824331 634825604 1273 False 985.5 1531 94.8870 450 2292 2 chr7B.!!$F1 1842
11 TraesCS5D01G395100 chr6D 298129810 298130733 923 True 1410.0 1410 94.1110 1243 2175 1 chr6D.!!$R1 932
12 TraesCS5D01G395100 chr6D 298139319 298140118 799 True 1310.0 1310 96.2550 450 1247 1 chr6D.!!$R2 797

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
477 479 0.322366 TGATTTGACATGCCGCCTGA 60.322 50.0 2.34 0.0 0.0 3.86 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2164 2213 0.036765 TTTACCCCACGCTACAGCTG 60.037 55.0 13.48 13.48 39.32 4.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
29 30 9.658475 TTTTCGACATTTTCATAGTTGTTACAG 57.342 29.630 0.00 0.00 0.0 2.74
477 479 0.322366 TGATTTGACATGCCGCCTGA 60.322 50.000 2.34 0.00 0.0 3.86
591 594 8.816640 AATCAGAATGTGGTGAATTTTTGTAC 57.183 30.769 0.00 0.00 37.4 2.90
1016 1026 7.831193 AGAATAAACCATGTATCTTGCTTCAGT 59.169 33.333 0.00 0.00 0.0 3.41
1837 1870 1.770294 GAGAGGGAGGATTCGTGTCT 58.230 55.000 0.00 0.00 0.0 3.41
1848 1881 1.020861 TTCGTGTCTAGCGGCGTCTA 61.021 55.000 9.37 9.71 0.0 2.59
1965 2003 6.961554 GTGTCGATGTTAAATGGAATCTTGAC 59.038 38.462 0.00 0.00 0.0 3.18
1972 2010 8.642935 TGTTAAATGGAATCTTGACATGGTTA 57.357 30.769 0.00 0.00 0.0 2.85
2006 2045 3.945346 TGGTTTGCACTGGACGTATTAT 58.055 40.909 0.00 0.00 0.0 1.28
2127 2176 1.817357 AGCGTGGGTTTTAGGTTAGC 58.183 50.000 0.00 0.00 0.0 3.09
2164 2213 3.916776 ACACGCGCTACTACTAACTTTTC 59.083 43.478 5.73 0.00 0.0 2.29
2292 2348 6.990798 ACTGGTAGTGTTTTTCCTAGTAGTC 58.009 40.000 0.00 0.00 0.0 2.59
2293 2349 6.017400 TGGTAGTGTTTTTCCTAGTAGTCG 57.983 41.667 0.00 0.00 0.0 4.18
2297 2353 4.989168 AGTGTTTTTCCTAGTAGTCGCTTG 59.011 41.667 0.00 0.00 0.0 4.01
2299 2355 5.235831 GTGTTTTTCCTAGTAGTCGCTTGTT 59.764 40.000 0.00 0.00 0.0 2.83
2300 2356 5.464389 TGTTTTTCCTAGTAGTCGCTTGTTC 59.536 40.000 0.00 0.00 0.0 3.18
2301 2357 3.863142 TTCCTAGTAGTCGCTTGTTCC 57.137 47.619 0.00 0.00 0.0 3.62
2302 2358 2.799017 TCCTAGTAGTCGCTTGTTCCA 58.201 47.619 0.00 0.00 0.0 3.53
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
556 559 6.150976 TCACCACATTCTGATTAACATGGAAC 59.849 38.462 0.00 0.00 0.00 3.62
1278 1290 2.037251 ACCCTTCATATGAATCCGACCG 59.963 50.000 18.26 5.27 33.01 4.79
1535 1551 5.300034 AGCTCAATGTCAAACATCACTTTGA 59.700 36.000 0.00 0.00 37.97 2.69
1618 1640 6.993902 TCGGGAAAGTGAAAACTTGTTAGTAT 59.006 34.615 0.00 0.00 33.17 2.12
1736 1769 3.695606 ATCTGTGCGACGTGGCCT 61.696 61.111 20.26 0.00 0.00 5.19
1848 1881 6.841755 AGATGTATCTACAAGGCTAGGAGTTT 59.158 38.462 0.00 0.00 39.99 2.66
1920 1957 4.083164 ACACACACAACTATCATCGTACGA 60.083 41.667 21.93 21.93 0.00 3.43
1922 1959 4.262277 CGACACACACAACTATCATCGTAC 59.738 45.833 0.00 0.00 0.00 3.67
1932 1969 5.277779 CCATTTAACATCGACACACACAACT 60.278 40.000 0.00 0.00 0.00 3.16
1965 2003 4.280677 ACCAAACCAACTCACATAACCATG 59.719 41.667 0.00 0.00 38.21 3.66
1972 2010 2.499289 TGCAAACCAAACCAACTCACAT 59.501 40.909 0.00 0.00 0.00 3.21
2049 2098 6.148150 TGACCCACGCTACTACTAAAAATTTG 59.852 38.462 0.00 0.00 0.00 2.32
2055 2104 4.870123 TTTGACCCACGCTACTACTAAA 57.130 40.909 0.00 0.00 0.00 1.85
2164 2213 0.036765 TTTACCCCACGCTACAGCTG 60.037 55.000 13.48 13.48 39.32 4.24
2196 2247 5.166398 ACGACGCTACAGCTAATTTTTAGT 58.834 37.500 0.00 0.00 39.32 2.24
2230 2282 2.642254 CGAGTAGCGTGGGTTCCCA 61.642 63.158 6.46 6.46 34.64 4.37


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.