Multiple sequence alignment - TraesCS5D01G394900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G394900 chr5D 100.000 2483 0 0 1 2483 462801638 462804120 0.000000e+00 4586
1 TraesCS5D01G394900 chr5D 97.269 1977 44 8 513 2483 388395324 388393352 0.000000e+00 3343
2 TraesCS5D01G394900 chr5D 88.747 471 39 7 886 1342 546919533 546920003 4.640000e-157 564
3 TraesCS5D01G394900 chr3D 97.438 2498 34 6 1 2483 22230202 22232684 0.000000e+00 4231
4 TraesCS5D01G394900 chr1B 95.888 1970 43 10 4 1969 629473254 629471319 0.000000e+00 3155
5 TraesCS5D01G394900 chr1B 97.151 351 9 1 2131 2481 629467709 629467360 2.130000e-165 592
6 TraesCS5D01G394900 chr1B 89.336 422 31 9 2040 2450 656522725 656522307 3.660000e-143 518
7 TraesCS5D01G394900 chr1B 91.133 203 17 1 4 205 656522439 656522237 8.750000e-70 274
8 TraesCS5D01G394900 chr1B 78.961 385 54 12 1386 1758 33004096 33003727 1.150000e-58 237
9 TraesCS5D01G394900 chr4B 95.423 1442 53 3 1054 2483 626627893 626626453 0.000000e+00 2285
10 TraesCS5D01G394900 chr4B 96.552 87 3 0 905 991 626627976 626627890 7.160000e-31 145
11 TraesCS5D01G394900 chr2B 95.694 836 29 6 1 830 485758482 485759316 0.000000e+00 1338
12 TraesCS5D01G394900 chr2B 95.084 834 29 8 4 830 632383113 632382285 0.000000e+00 1303
13 TraesCS5D01G394900 chr2B 86.925 413 38 10 2040 2450 632382273 632381875 1.350000e-122 449
14 TraesCS5D01G394900 chr2B 90.361 166 15 1 1760 1924 237983331 237983496 1.500000e-52 217
15 TraesCS5D01G394900 chr2B 94.643 112 6 0 1925 2036 87532007 87531896 9.130000e-40 174
16 TraesCS5D01G394900 chr2D 95.449 835 29 7 4 830 617125067 617124234 0.000000e+00 1323
17 TraesCS5D01G394900 chr6B 94.952 832 35 6 4 830 681261864 681261035 0.000000e+00 1297
18 TraesCS5D01G394900 chr6B 87.379 412 37 9 2040 2450 681261023 681260626 2.250000e-125 459
19 TraesCS5D01G394900 chr6D 95.185 623 24 5 213 830 423499016 423498395 0.000000e+00 979
20 TraesCS5D01G394900 chr6D 87.915 422 37 9 2040 2450 469906269 469905851 3.710000e-133 484
21 TraesCS5D01G394900 chr1D 96.602 412 13 1 213 623 495445890 495445479 0.000000e+00 682
22 TraesCS5D01G394900 chr4A 88.298 470 42 5 886 1342 621818352 621817883 3.610000e-153 551
23 TraesCS5D01G394900 chr4A 96.522 115 4 0 1922 2036 739280031 739280145 9.060000e-45 191
24 TraesCS5D01G394900 chr5B 88.110 471 42 10 886 1342 690091579 690092049 4.670000e-152 547
25 TraesCS5D01G394900 chr4D 88.278 418 39 7 2040 2450 49769418 49769832 2.220000e-135 492
26 TraesCS5D01G394900 chr4D 89.806 206 20 1 1 205 49769697 49769902 1.890000e-66 263
27 TraesCS5D01G394900 chr3B 90.148 203 19 1 4 205 174459533 174459331 1.890000e-66 263
28 TraesCS5D01G394900 chr1A 97.368 114 3 0 1923 2036 581505094 581505207 7.010000e-46 195
29 TraesCS5D01G394900 chr5A 95.652 115 5 0 1922 2036 168276209 168276323 4.220000e-43 185
30 TraesCS5D01G394900 chr5A 95.614 114 4 1 1923 2036 671540819 671540707 5.460000e-42 182
31 TraesCS5D01G394900 chr7D 93.103 116 6 2 1923 2036 415038270 415038385 4.250000e-38 169


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G394900 chr5D 462801638 462804120 2482 False 4586.0 4586 100.0000 1 2483 1 chr5D.!!$F1 2482
1 TraesCS5D01G394900 chr5D 388393352 388395324 1972 True 3343.0 3343 97.2690 513 2483 1 chr5D.!!$R1 1970
2 TraesCS5D01G394900 chr3D 22230202 22232684 2482 False 4231.0 4231 97.4380 1 2483 1 chr3D.!!$F1 2482
3 TraesCS5D01G394900 chr1B 629467360 629473254 5894 True 1873.5 3155 96.5195 4 2481 2 chr1B.!!$R2 2477
4 TraesCS5D01G394900 chr4B 626626453 626627976 1523 True 1215.0 2285 95.9875 905 2483 2 chr4B.!!$R1 1578
5 TraesCS5D01G394900 chr2B 485758482 485759316 834 False 1338.0 1338 95.6940 1 830 1 chr2B.!!$F2 829
6 TraesCS5D01G394900 chr2B 632381875 632383113 1238 True 876.0 1303 91.0045 4 2450 2 chr2B.!!$R2 2446
7 TraesCS5D01G394900 chr2D 617124234 617125067 833 True 1323.0 1323 95.4490 4 830 1 chr2D.!!$R1 826
8 TraesCS5D01G394900 chr6B 681260626 681261864 1238 True 878.0 1297 91.1655 4 2450 2 chr6B.!!$R1 2446
9 TraesCS5D01G394900 chr6D 423498395 423499016 621 True 979.0 979 95.1850 213 830 1 chr6D.!!$R1 617

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
235 237 1.145377 GATGGACCGGGCAACGTAT 59.855 57.895 11.0 0.0 42.24 3.06 F
702 717 4.532521 AGGGGATATATCAAGGTAGTGTGC 59.467 45.833 14.6 0.0 0.00 4.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1187 1208 0.250727 CTGGCGGAAAAGAGGAACCA 60.251 55.000 0.0 0.0 0.00 3.67 R
1824 1847 4.825085 TGTAGGGAAAAGCCTTGTGTAAAG 59.175 41.667 0.0 0.0 36.66 1.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
95 97 9.787532 AAAATGATCAAAGAAATACATGTACCG 57.212 29.630 7.96 0.00 0.00 4.02
235 237 1.145377 GATGGACCGGGCAACGTAT 59.855 57.895 11.00 0.00 42.24 3.06
283 285 8.633561 CCTCTTAAGTTGATTGGTTTCTCTTTT 58.366 33.333 1.63 0.00 0.00 2.27
702 717 4.532521 AGGGGATATATCAAGGTAGTGTGC 59.467 45.833 14.60 0.00 0.00 4.57
1076 1097 5.447818 GCAAGCTTCCATACACAGTTATCAC 60.448 44.000 0.00 0.00 0.00 3.06
1109 1130 5.483231 TGAAATATTGGCCCATCAGAAACAA 59.517 36.000 0.00 0.00 0.00 2.83
1187 1208 2.161855 TGCGGAGTTTCAGAAATGCAT 58.838 42.857 0.00 0.00 0.00 3.96
1357 1378 6.645827 TCCTTTTGTCGTACGTGAAATATGAA 59.354 34.615 16.05 0.11 0.00 2.57
1630 1653 4.000325 TCGGTGTTGAACAGGTCATTATG 59.000 43.478 0.00 0.00 35.70 1.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
53 54 9.955208 TTGATCATTTTTCATCCGAATAATCAG 57.045 29.630 0.00 0.00 32.48 2.90
283 285 6.009589 TGAGACCATAGAAAAAGGAATGCAA 58.990 36.000 0.00 0.00 0.00 4.08
672 687 9.805204 ACTACCTTGATATATCCCCTTATTGAT 57.195 33.333 10.25 0.00 0.00 2.57
1003 1024 5.348418 CAGTAAGACAACTGTTGATGGTG 57.652 43.478 26.00 11.44 41.63 4.17
1076 1097 1.880027 GCCAATATTTCAGTAGGCCCG 59.120 52.381 0.00 0.00 36.17 6.13
1187 1208 0.250727 CTGGCGGAAAAGAGGAACCA 60.251 55.000 0.00 0.00 0.00 3.67
1357 1378 5.606348 TTTGAAACTAAAGCATTGGGTGT 57.394 34.783 0.00 0.00 0.00 4.16
1824 1847 4.825085 TGTAGGGAAAAGCCTTGTGTAAAG 59.175 41.667 0.00 0.00 36.66 1.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.