Multiple sequence alignment - TraesCS5D01G394800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G394800 chr5D 100.000 3266 0 0 1 3266 462797336 462794071 0.000000e+00 6032.0
1 TraesCS5D01G394800 chr2B 92.842 3269 174 23 1 3266 645134808 645131597 0.000000e+00 4686.0
2 TraesCS5D01G394800 chr2B 81.591 440 72 6 2815 3252 253263487 253263919 4.010000e-94 355.0
3 TraesCS5D01G394800 chr2B 82.292 192 28 5 625 812 398574432 398574621 9.380000e-36 161.0
4 TraesCS5D01G394800 chr6D 99.349 1842 9 3 1426 3266 288467007 288468846 0.000000e+00 3332.0
5 TraesCS5D01G394800 chr6D 98.908 1373 14 1 1 1373 288465638 288467009 0.000000e+00 2451.0
6 TraesCS5D01G394800 chr3D 97.119 1527 34 7 1741 3266 283965217 283963700 0.000000e+00 2567.0
7 TraesCS5D01G394800 chr3D 95.376 1384 37 3 1 1381 283967582 283966223 0.000000e+00 2176.0
8 TraesCS5D01G394800 chr3D 97.101 276 8 0 1443 1718 283966214 283965939 1.770000e-127 466.0
9 TraesCS5D01G394800 chr2A 92.043 1219 86 7 1810 3026 453508537 453507328 0.000000e+00 1703.0
10 TraesCS5D01G394800 chr2A 82.766 441 66 7 2815 3252 211908144 211908577 5.110000e-103 385.0
11 TraesCS5D01G394800 chr4A 91.181 1236 91 10 1801 3021 18745888 18747120 0.000000e+00 1663.0
12 TraesCS5D01G394800 chr4A 89.345 901 81 14 915 1803 705180497 705179600 0.000000e+00 1118.0
13 TraesCS5D01G394800 chr4A 77.477 444 60 24 2357 2771 12652279 12651847 2.530000e-56 230.0
14 TraesCS5D01G394800 chr4A 94.737 38 2 0 780 817 709194320 709194283 3.520000e-05 60.2
15 TraesCS5D01G394800 chr5A 91.108 1237 93 10 1807 3030 4799394 4800626 0.000000e+00 1659.0
16 TraesCS5D01G394800 chr5A 91.538 780 48 8 2500 3266 554339457 554338683 0.000000e+00 1059.0
17 TraesCS5D01G394800 chr5A 93.827 486 27 3 1976 2461 554339940 554339458 0.000000e+00 728.0
18 TraesCS5D01G394800 chr7A 90.000 1010 79 5 816 1803 22920191 22919182 0.000000e+00 1286.0
19 TraesCS5D01G394800 chr7D 89.909 991 87 9 825 1803 22530289 22529300 0.000000e+00 1264.0
20 TraesCS5D01G394800 chr7D 91.111 45 2 2 773 817 627929007 627929049 3.520000e-05 60.2
21 TraesCS5D01G394800 chr7D 89.130 46 4 1 772 817 589337992 589338036 4.550000e-04 56.5
22 TraesCS5D01G394800 chr3A 91.927 768 50 7 2500 3263 454088646 454089405 0.000000e+00 1064.0
23 TraesCS5D01G394800 chr3A 91.604 667 51 5 1796 2461 454087983 454088645 0.000000e+00 917.0
24 TraesCS5D01G394800 chr2D 82.993 441 64 8 2815 3252 196345576 196346008 3.950000e-104 388.0
25 TraesCS5D01G394800 chr2D 84.577 201 18 10 625 817 330453726 330453921 1.550000e-43 187.0
26 TraesCS5D01G394800 chr2D 91.304 46 1 3 773 817 105192994 105193037 3.520000e-05 60.2
27 TraesCS5D01G394800 chr7B 83.553 304 44 6 2951 3250 355675501 355675802 2.480000e-71 279.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G394800 chr5D 462794071 462797336 3265 True 6032.000000 6032 100.0000 1 3266 1 chr5D.!!$R1 3265
1 TraesCS5D01G394800 chr2B 645131597 645134808 3211 True 4686.000000 4686 92.8420 1 3266 1 chr2B.!!$R1 3265
2 TraesCS5D01G394800 chr6D 288465638 288468846 3208 False 2891.500000 3332 99.1285 1 3266 2 chr6D.!!$F1 3265
3 TraesCS5D01G394800 chr3D 283963700 283967582 3882 True 1736.333333 2567 96.5320 1 3266 3 chr3D.!!$R1 3265
4 TraesCS5D01G394800 chr2A 453507328 453508537 1209 True 1703.000000 1703 92.0430 1810 3026 1 chr2A.!!$R1 1216
5 TraesCS5D01G394800 chr4A 18745888 18747120 1232 False 1663.000000 1663 91.1810 1801 3021 1 chr4A.!!$F1 1220
6 TraesCS5D01G394800 chr4A 705179600 705180497 897 True 1118.000000 1118 89.3450 915 1803 1 chr4A.!!$R2 888
7 TraesCS5D01G394800 chr5A 4799394 4800626 1232 False 1659.000000 1659 91.1080 1807 3030 1 chr5A.!!$F1 1223
8 TraesCS5D01G394800 chr5A 554338683 554339940 1257 True 893.500000 1059 92.6825 1976 3266 2 chr5A.!!$R1 1290
9 TraesCS5D01G394800 chr7A 22919182 22920191 1009 True 1286.000000 1286 90.0000 816 1803 1 chr7A.!!$R1 987
10 TraesCS5D01G394800 chr7D 22529300 22530289 989 True 1264.000000 1264 89.9090 825 1803 1 chr7D.!!$R1 978
11 TraesCS5D01G394800 chr3A 454087983 454089405 1422 False 990.500000 1064 91.7655 1796 3263 2 chr3A.!!$F1 1467

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
435 439 0.171455 CTCTGCACCGGTGAGTAGAC 59.829 60.00 38.30 19.13 0.0 2.59 F
896 904 5.407407 AGTTTCCTGATCATCAGTTACGT 57.593 39.13 13.82 0.00 42.8 3.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1417 1484 1.079819 GGTAGCGACTCTTGCAGCA 60.08 57.895 0.0 0.0 33.85 4.41 R
2858 3670 0.590195 GCAGGAGCTGAACAACTGTG 59.41 55.000 0.0 0.0 37.91 3.66 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
221 222 4.822350 GGATTGACCTAGCCAAATTACCTC 59.178 45.833 0.85 0.00 35.41 3.85
435 439 0.171455 CTCTGCACCGGTGAGTAGAC 59.829 60.000 38.30 19.13 0.00 2.59
896 904 5.407407 AGTTTCCTGATCATCAGTTACGT 57.593 39.130 13.82 0.00 42.80 3.57
1417 1484 3.703052 CTGCTCTGCCCTTTAATCCATTT 59.297 43.478 0.00 0.00 0.00 2.32
1423 1490 2.093553 GCCCTTTAATCCATTTGCTGCA 60.094 45.455 0.00 0.00 0.00 4.41
1428 1495 5.337009 CCTTTAATCCATTTGCTGCAAGAGT 60.337 40.000 15.39 11.12 34.07 3.24
1629 1697 6.741992 TGCAATTGTCGAGTGATTTCTTAT 57.258 33.333 7.40 0.00 0.00 1.73
2308 3108 0.738762 CAGCTACAGTGCGTGCATCT 60.739 55.000 0.00 0.00 38.13 2.90
2858 3670 3.995199 TGATTGATGGCGATTCTAGGTC 58.005 45.455 0.00 0.00 0.00 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
221 222 7.387948 ACACTGCCTTTTATACTGTTTACAGAG 59.612 37.037 16.31 2.52 46.59 3.35
435 439 8.795786 TCAATTTAATTTGGAAGAAGTGTTCG 57.204 30.769 9.56 0.00 34.02 3.95
588 592 0.307760 CTTGCCGACTGGAACACAAC 59.692 55.000 0.00 0.00 37.49 3.32
864 872 9.166173 CTGATGATCAGGAAACTAACAAATGTA 57.834 33.333 14.56 0.00 40.71 2.29
896 904 7.844493 TGTACTAAAGGTAGTTCCAGAGAAA 57.156 36.000 0.00 0.00 41.06 2.52
1387 1454 2.596851 GGGCAGAGCAGGTTCAGGA 61.597 63.158 0.00 0.00 0.00 3.86
1417 1484 1.079819 GGTAGCGACTCTTGCAGCA 60.080 57.895 0.00 0.00 33.85 4.41
1423 1490 6.062749 TGATAGACTTATGGTAGCGACTCTT 58.937 40.000 0.00 0.00 0.00 2.85
1428 1495 4.142038 TGCTGATAGACTTATGGTAGCGA 58.858 43.478 0.00 0.00 32.88 4.93
1629 1697 6.539173 TCTTATTTGCAGGAAAGTTAGACCA 58.461 36.000 0.00 0.00 0.00 4.02
1735 1834 8.565416 AGAACTTGGCTTTTATGTTGTACTAAC 58.435 33.333 0.00 0.00 0.00 2.34
2703 3514 2.297315 CACTCTGACAGTGCTGGTAAGA 59.703 50.000 1.59 3.11 46.30 2.10
2858 3670 0.590195 GCAGGAGCTGAACAACTGTG 59.410 55.000 0.00 0.00 37.91 3.66
3081 3902 9.973450 GAATATATTCTGCTGAAACTCTGACTA 57.027 33.333 16.73 0.00 35.63 2.59


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.