Multiple sequence alignment - TraesCS5D01G385700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G385700 chr5D 100.000 3140 0 0 1 3140 455047970 455051109 0.000000e+00 5799.0
1 TraesCS5D01G385700 chr5D 99.522 3140 14 1 1 3140 454976723 454979861 0.000000e+00 5714.0
2 TraesCS5D01G385700 chr5D 99.230 2079 13 3 127 2205 455220817 455222892 0.000000e+00 3747.0
3 TraesCS5D01G385700 chr5D 99.124 1827 7 2 1323 3140 455121047 455122873 0.000000e+00 3277.0
4 TraesCS5D01G385700 chr5D 99.215 1147 8 1 1 1147 455119904 455121049 0.000000e+00 2067.0
5 TraesCS5D01G385700 chr5D 75.777 611 114 23 1313 1909 425840605 425841195 8.580000e-71 278.0
6 TraesCS5D01G385700 chr5D 89.524 210 19 2 1 207 486452915 486452706 2.400000e-66 263.0
7 TraesCS5D01G385700 chr5A 96.958 1019 21 3 1210 2224 572391396 572392408 0.000000e+00 1701.0
8 TraesCS5D01G385700 chr5A 94.967 457 11 3 764 1217 572373145 572373592 0.000000e+00 706.0
9 TraesCS5D01G385700 chr5A 89.899 495 30 11 2666 3140 572392548 572393042 1.240000e-173 619.0
10 TraesCS5D01G385700 chr3B 81.200 883 137 18 1209 2078 236496439 236495573 0.000000e+00 684.0
11 TraesCS5D01G385700 chr3B 97.531 81 2 0 207 287 65944204 65944124 4.220000e-29 139.0
12 TraesCS5D01G385700 chr3D 80.974 883 139 18 1209 2078 159786775 159785909 0.000000e+00 673.0
13 TraesCS5D01G385700 chr3D 89.423 208 21 1 1 207 475651834 475652041 8.640000e-66 261.0
14 TraesCS5D01G385700 chr3D 91.667 168 13 1 2338 2504 510649343 510649510 6.770000e-57 231.0
15 TraesCS5D01G385700 chr3D 92.029 138 10 1 2368 2504 510649717 510649580 3.200000e-45 193.0
16 TraesCS5D01G385700 chr7B 93.750 208 11 2 1 207 579413414 579413620 8.460000e-81 311.0
17 TraesCS5D01G385700 chr7B 91.429 210 15 2 1 207 179901058 179901267 5.130000e-73 285.0
18 TraesCS5D01G385700 chr7B 93.382 136 9 0 304 439 179901262 179901397 5.310000e-48 202.0
19 TraesCS5D01G385700 chr2B 91.827 208 16 1 1 207 159251994 159251787 3.960000e-74 289.0
20 TraesCS5D01G385700 chr2B 97.531 81 2 0 207 287 66372518 66372598 4.220000e-29 139.0
21 TraesCS5D01G385700 chr2B 95.556 45 2 0 2748 2792 779343843 779343887 4.340000e-09 73.1
22 TraesCS5D01G385700 chr1B 91.827 208 16 1 1 207 571365096 571364889 3.960000e-74 289.0
23 TraesCS5D01G385700 chr1B 86.957 184 20 4 19 200 33838552 33838733 1.480000e-48 204.0
24 TraesCS5D01G385700 chr1B 90.625 96 7 2 191 285 341701461 341701555 3.290000e-25 126.0
25 TraesCS5D01G385700 chr6D 82.373 295 37 10 1790 2078 411221475 411221190 3.130000e-60 243.0
26 TraesCS5D01G385700 chr6B 81.379 290 46 5 1790 2078 618142577 618142295 2.440000e-56 230.0
27 TraesCS5D01G385700 chr6B 94.253 87 4 1 200 286 346734963 346735048 7.070000e-27 132.0
28 TraesCS5D01G385700 chr6B 86.765 68 9 0 368 435 522422396 522422463 3.360000e-10 76.8
29 TraesCS5D01G385700 chr3A 92.121 165 10 3 2342 2504 497658145 497657982 2.440000e-56 230.0
30 TraesCS5D01G385700 chr3A 94.915 59 3 0 2749 2807 719339013 719338955 3.330000e-15 93.5
31 TraesCS5D01G385700 chr4A 90.566 159 13 2 2347 2504 514415194 514415037 3.170000e-50 209.0
32 TraesCS5D01G385700 chr7D 87.425 167 20 1 2339 2504 428025774 428025608 1.150000e-44 191.0
33 TraesCS5D01G385700 chr5B 88.125 160 18 1 2340 2498 43895849 43896008 4.130000e-44 189.0
34 TraesCS5D01G385700 chr5B 97.531 81 2 0 207 287 511805156 511805236 4.220000e-29 139.0
35 TraesCS5D01G385700 chr4D 85.714 161 22 1 2338 2497 2000413 2000253 5.390000e-38 169.0
36 TraesCS5D01G385700 chr7A 86.923 130 17 0 306 435 624639230 624639359 2.520000e-31 147.0
37 TraesCS5D01G385700 chr7A 88.462 52 6 0 387 438 75200090 75200039 2.610000e-06 63.9
38 TraesCS5D01G385700 chr2A 86.508 126 15 2 311 435 77327050 77326926 1.520000e-28 137.0
39 TraesCS5D01G385700 chr4B 90.625 96 7 2 195 289 173125937 173126031 3.290000e-25 126.0
40 TraesCS5D01G385700 chr4B 93.333 45 3 0 380 424 165185562 165185606 2.020000e-07 67.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G385700 chr5D 455047970 455051109 3139 False 5799 5799 100.0000 1 3140 1 chr5D.!!$F3 3139
1 TraesCS5D01G385700 chr5D 454976723 454979861 3138 False 5714 5714 99.5220 1 3140 1 chr5D.!!$F2 3139
2 TraesCS5D01G385700 chr5D 455220817 455222892 2075 False 3747 3747 99.2300 127 2205 1 chr5D.!!$F4 2078
3 TraesCS5D01G385700 chr5D 455119904 455122873 2969 False 2672 3277 99.1695 1 3140 2 chr5D.!!$F5 3139
4 TraesCS5D01G385700 chr5D 425840605 425841195 590 False 278 278 75.7770 1313 1909 1 chr5D.!!$F1 596
5 TraesCS5D01G385700 chr5A 572391396 572393042 1646 False 1160 1701 93.4285 1210 3140 2 chr5A.!!$F2 1930
6 TraesCS5D01G385700 chr3B 236495573 236496439 866 True 684 684 81.2000 1209 2078 1 chr3B.!!$R2 869
7 TraesCS5D01G385700 chr3D 159785909 159786775 866 True 673 673 80.9740 1209 2078 1 chr3D.!!$R1 869

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
506 507 1.273838 ACTAATCCCCCAGCTGACTCA 60.274 52.381 17.39 0.0 0.0 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2515 2529 2.285069 TACCCTCGGTGCACCCAT 60.285 61.111 29.95 13.09 36.19 4.0 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
152 153 3.057315 GCATATTGTCCACACAAGCAAGT 60.057 43.478 0.00 0.0 45.85 3.16
506 507 1.273838 ACTAATCCCCCAGCTGACTCA 60.274 52.381 17.39 0.0 0.00 3.41
526 527 6.131961 ACTCATAGGTGTAGTATTACCCGTT 58.868 40.000 3.63 0.0 37.70 4.44
527 528 6.608808 ACTCATAGGTGTAGTATTACCCGTTT 59.391 38.462 3.63 0.0 37.70 3.60
668 669 6.179906 AGAGAGAATGTTGTGAAGGAAAGA 57.820 37.500 0.00 0.0 0.00 2.52
750 751 5.407084 CCTCTCGTCTCCTTTTCTTTCTTTC 59.593 44.000 0.00 0.0 0.00 2.62
928 929 4.454678 TGCATGTCCTAATCACCAATCTC 58.545 43.478 0.00 0.0 0.00 2.75
2515 2529 4.898265 AGGAGCTCTATATGTCTTCTTGCA 59.102 41.667 14.64 0.0 0.00 4.08
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
506 507 6.809869 GTGAAACGGGTAATACTACACCTAT 58.190 40.000 0.00 0.00 35.04 2.57
526 527 3.251479 AGATGTAGCATTGCTCGTGAA 57.749 42.857 15.81 0.00 40.44 3.18
527 528 2.967599 AGATGTAGCATTGCTCGTGA 57.032 45.000 15.81 0.00 40.44 4.35
668 669 5.148651 ACAACTTACGAAGCCTCACTTAT 57.851 39.130 0.00 0.00 39.29 1.73
750 751 8.634475 AAAGGAGACGAGAAAATTTCAAAAAG 57.366 30.769 8.55 0.00 0.00 2.27
928 929 5.299148 CAATGCAGAAGGAAGGAGATCTAG 58.701 45.833 0.00 0.00 0.00 2.43
2515 2529 2.285069 TACCCTCGGTGCACCCAT 60.285 61.111 29.95 13.09 36.19 4.00


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.