Multiple sequence alignment - TraesCS5D01G371900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G371900 chr5D 100.000 1612 0 0 551 2162 446173823 446175434 0.000000e+00 2977
1 TraesCS5D01G371900 chr5D 98.994 1193 12 0 970 2162 503218676 503219868 0.000000e+00 2137
2 TraesCS5D01G371900 chr5D 98.659 1193 16 0 970 2162 503277768 503276576 0.000000e+00 2115
3 TraesCS5D01G371900 chr5D 98.507 402 3 3 551 951 446186385 446186784 0.000000e+00 706
4 TraesCS5D01G371900 chr5D 100.000 227 0 0 1 227 446173273 446173499 9.230000e-114 420
5 TraesCS5D01G371900 chr5D 97.425 233 0 2 1 227 446186070 446186302 2.010000e-105 392
6 TraesCS5D01G371900 chr5D 90.517 232 11 5 1 221 227866589 227866358 1.620000e-76 296
7 TraesCS5D01G371900 chr1A 99.078 1193 11 0 970 2162 554512706 554513898 0.000000e+00 2143
8 TraesCS5D01G371900 chr3B 98.994 1193 12 0 970 2162 201527482 201528674 0.000000e+00 2137
9 TraesCS5D01G371900 chr3B 90.909 242 18 3 551 788 330709143 330709384 2.680000e-84 322
10 TraesCS5D01G371900 chr3B 93.443 122 8 0 551 672 330752931 330753052 4.740000e-42 182
11 TraesCS5D01G371900 chr2D 98.826 1193 14 0 970 2162 272564413 272565605 0.000000e+00 2126
12 TraesCS5D01G371900 chr2D 92.609 230 8 7 1 221 331953053 331953282 2.680000e-84 322
13 TraesCS5D01G371900 chr3D 98.743 1193 14 1 970 2162 589279086 589277895 0.000000e+00 2119
14 TraesCS5D01G371900 chrUn 98.659 1193 16 0 970 2162 346596036 346594844 0.000000e+00 2115
15 TraesCS5D01G371900 chr6D 98.575 1193 17 0 970 2162 168255384 168256576 0.000000e+00 2109
16 TraesCS5D01G371900 chr6D 94.397 232 5 6 3 227 102271265 102271495 1.230000e-92 350
17 TraesCS5D01G371900 chr6D 96.296 108 4 0 551 658 102271578 102271685 6.130000e-41 178
18 TraesCS5D01G371900 chr1D 98.575 1193 16 1 970 2162 254397651 254396460 0.000000e+00 2108
19 TraesCS5D01G371900 chr7D 94.359 390 22 0 551 940 208870224 208870613 1.100000e-167 599
20 TraesCS5D01G371900 chr7D 94.783 230 8 4 1 227 208869913 208870141 2.640000e-94 355
21 TraesCS5D01G371900 chr7D 77.483 302 41 25 655 947 523231669 523231952 2.870000e-34 156
22 TraesCS5D01G371900 chr4D 93.893 393 23 1 551 943 230795290 230795681 1.850000e-165 592
23 TraesCS5D01G371900 chr4D 96.522 230 5 2 1 227 230794979 230795208 5.630000e-101 377
24 TraesCS5D01G371900 chr4D 92.641 231 7 5 1 221 207143756 207143986 7.440000e-85 324
25 TraesCS5D01G371900 chr4D 89.286 224 13 8 1 217 338858743 338858524 9.830000e-69 270
26 TraesCS5D01G371900 chr4D 89.286 224 13 8 1 217 338866736 338866517 9.830000e-69 270
27 TraesCS5D01G371900 chr6B 90.456 241 21 2 551 789 250427979 250427739 1.250000e-82 316
28 TraesCS5D01G371900 chr6B 91.628 215 18 0 551 765 250471736 250471522 4.510000e-77 298
29 TraesCS5D01G371900 chr6B 88.655 238 24 3 553 787 250455389 250455152 9.770000e-74 287
30 TraesCS5D01G371900 chr6B 86.667 240 28 4 639 877 388412347 388412111 1.650000e-66 263
31 TraesCS5D01G371900 chr2B 89.954 219 22 0 622 840 435462704 435462922 1.260000e-72 283
32 TraesCS5D01G371900 chr2B 90.476 105 8 2 844 948 94308648 94308546 1.040000e-28 137
33 TraesCS5D01G371900 chr7A 90.476 105 8 2 844 948 727657632 727657734 1.040000e-28 137
34 TraesCS5D01G371900 chr7A 90.476 105 8 2 844 948 727666157 727666259 1.040000e-28 137
35 TraesCS5D01G371900 chr2A 90.476 105 8 2 844 948 593704831 593704933 1.040000e-28 137
36 TraesCS5D01G371900 chr3A 89.524 105 9 2 844 948 732251237 732251135 4.840000e-27 132


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G371900 chr5D 446173273 446175434 2161 False 1698.5 2977 100.0000 1 2162 2 chr5D.!!$F2 2161
1 TraesCS5D01G371900 chr5D 503218676 503219868 1192 False 2137.0 2137 98.9940 970 2162 1 chr5D.!!$F1 1192
2 TraesCS5D01G371900 chr5D 503276576 503277768 1192 True 2115.0 2115 98.6590 970 2162 1 chr5D.!!$R2 1192
3 TraesCS5D01G371900 chr5D 446186070 446186784 714 False 549.0 706 97.9660 1 951 2 chr5D.!!$F3 950
4 TraesCS5D01G371900 chr1A 554512706 554513898 1192 False 2143.0 2143 99.0780 970 2162 1 chr1A.!!$F1 1192
5 TraesCS5D01G371900 chr3B 201527482 201528674 1192 False 2137.0 2137 98.9940 970 2162 1 chr3B.!!$F1 1192
6 TraesCS5D01G371900 chr2D 272564413 272565605 1192 False 2126.0 2126 98.8260 970 2162 1 chr2D.!!$F1 1192
7 TraesCS5D01G371900 chr3D 589277895 589279086 1191 True 2119.0 2119 98.7430 970 2162 1 chr3D.!!$R1 1192
8 TraesCS5D01G371900 chrUn 346594844 346596036 1192 True 2115.0 2115 98.6590 970 2162 1 chrUn.!!$R1 1192
9 TraesCS5D01G371900 chr6D 168255384 168256576 1192 False 2109.0 2109 98.5750 970 2162 1 chr6D.!!$F1 1192
10 TraesCS5D01G371900 chr1D 254396460 254397651 1191 True 2108.0 2108 98.5750 970 2162 1 chr1D.!!$R1 1192
11 TraesCS5D01G371900 chr7D 208869913 208870613 700 False 477.0 599 94.5710 1 940 2 chr7D.!!$F2 939
12 TraesCS5D01G371900 chr4D 230794979 230795681 702 False 484.5 592 95.2075 1 943 2 chr4D.!!$F2 942

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
963 971 0.865362 GTCCCCCTCCCTACCATCTA 59.135 60.0 0.0 0.0 0.0 1.98 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1769 1777 3.320826 TCTCCGAATATTTGCCATCTCGA 59.679 43.478 0.0 0.0 0.0 4.04 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
842 850 2.764128 GATGAGCCCGACCCCTCA 60.764 66.667 0.00 0.00 41.81 3.86
959 967 4.791069 GCGTCCCCCTCCCTACCA 62.791 72.222 0.00 0.00 0.00 3.25
960 968 2.285868 CGTCCCCCTCCCTACCAT 59.714 66.667 0.00 0.00 0.00 3.55
961 969 1.837499 CGTCCCCCTCCCTACCATC 60.837 68.421 0.00 0.00 0.00 3.51
962 970 1.632740 GTCCCCCTCCCTACCATCT 59.367 63.158 0.00 0.00 0.00 2.90
963 971 0.865362 GTCCCCCTCCCTACCATCTA 59.135 60.000 0.00 0.00 0.00 1.98
964 972 1.437547 GTCCCCCTCCCTACCATCTAT 59.562 57.143 0.00 0.00 0.00 1.98
965 973 1.437149 TCCCCCTCCCTACCATCTATG 59.563 57.143 0.00 0.00 0.00 2.23
966 974 1.152271 CCCCCTCCCTACCATCTATGT 59.848 57.143 0.00 0.00 0.00 2.29
967 975 2.541466 CCCCTCCCTACCATCTATGTC 58.459 57.143 0.00 0.00 0.00 3.06
968 976 2.112691 CCCCTCCCTACCATCTATGTCT 59.887 54.545 0.00 0.00 0.00 3.41
1050 1058 4.108902 CGGTGTCGTCCATGGATG 57.891 61.111 25.71 25.71 0.00 3.51
1294 1302 3.898123 AGGTAGTCGATGGCTATTCACAT 59.102 43.478 0.00 0.00 0.00 3.21
1623 1631 1.667830 CCGTTCGTGTGCATCCAGT 60.668 57.895 0.00 0.00 0.00 4.00
1686 1694 4.584325 GCTTTAACCATTCAGCCATGGATA 59.416 41.667 18.40 0.00 46.18 2.59
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
943 951 1.837499 GATGGTAGGGAGGGGGACG 60.837 68.421 0.00 0.00 0.00 4.79
944 952 0.865362 TAGATGGTAGGGAGGGGGAC 59.135 60.000 0.00 0.00 0.00 4.46
945 953 1.437149 CATAGATGGTAGGGAGGGGGA 59.563 57.143 0.00 0.00 0.00 4.81
946 954 1.152271 ACATAGATGGTAGGGAGGGGG 59.848 57.143 0.00 0.00 0.00 5.40
950 958 7.122055 GTCATAAGAGACATAGATGGTAGGGAG 59.878 44.444 0.00 0.00 38.40 4.30
951 959 6.948886 GTCATAAGAGACATAGATGGTAGGGA 59.051 42.308 0.00 0.00 38.40 4.20
952 960 6.153680 GGTCATAAGAGACATAGATGGTAGGG 59.846 46.154 0.00 0.00 40.29 3.53
953 961 6.951198 AGGTCATAAGAGACATAGATGGTAGG 59.049 42.308 0.00 0.00 40.29 3.18
954 962 7.122055 GGAGGTCATAAGAGACATAGATGGTAG 59.878 44.444 0.00 0.00 40.29 3.18
955 963 6.948886 GGAGGTCATAAGAGACATAGATGGTA 59.051 42.308 0.00 0.00 40.29 3.25
956 964 5.777732 GGAGGTCATAAGAGACATAGATGGT 59.222 44.000 0.00 0.00 40.29 3.55
957 965 5.186797 GGGAGGTCATAAGAGACATAGATGG 59.813 48.000 0.00 0.00 40.29 3.51
958 966 5.186797 GGGGAGGTCATAAGAGACATAGATG 59.813 48.000 0.00 0.00 40.29 2.90
959 967 5.337788 GGGGAGGTCATAAGAGACATAGAT 58.662 45.833 0.00 0.00 40.29 1.98
960 968 4.449376 GGGGGAGGTCATAAGAGACATAGA 60.449 50.000 0.00 0.00 40.29 1.98
961 969 3.835395 GGGGGAGGTCATAAGAGACATAG 59.165 52.174 0.00 0.00 40.29 2.23
962 970 3.471306 AGGGGGAGGTCATAAGAGACATA 59.529 47.826 0.00 0.00 40.29 2.29
963 971 2.251338 AGGGGGAGGTCATAAGAGACAT 59.749 50.000 0.00 0.00 40.29 3.06
964 972 1.651770 AGGGGGAGGTCATAAGAGACA 59.348 52.381 0.00 0.00 40.29 3.41
965 973 2.090999 AGAGGGGGAGGTCATAAGAGAC 60.091 54.545 0.00 0.00 37.80 3.36
966 974 2.227703 AGAGGGGGAGGTCATAAGAGA 58.772 52.381 0.00 0.00 0.00 3.10
967 975 2.785357 AGAGGGGGAGGTCATAAGAG 57.215 55.000 0.00 0.00 0.00 2.85
968 976 3.758787 GCATAGAGGGGGAGGTCATAAGA 60.759 52.174 0.00 0.00 0.00 2.10
1038 1046 5.820423 ACGAAATAATTTCATCCATGGACGA 59.180 36.000 18.99 12.63 39.63 4.20
1050 1058 8.807581 GTGAAATCCAATCCACGAAATAATTTC 58.192 33.333 0.00 0.00 36.32 2.17
1294 1302 5.367352 TCTTCTTTGGTGTTAAGGTGGTAGA 59.633 40.000 0.00 0.00 0.00 2.59
1623 1631 6.782988 TGGTAAATTTGTGGGTTCAATTCCTA 59.217 34.615 0.00 0.00 0.00 2.94
1637 1645 7.102993 GCCCAACTCATAATTGGTAAATTTGT 58.897 34.615 0.00 0.00 44.46 2.83
1686 1694 5.507482 CGATGTACGATGATCCCTGTTAAGT 60.507 44.000 0.00 0.00 45.77 2.24
1769 1777 3.320826 TCTCCGAATATTTGCCATCTCGA 59.679 43.478 0.00 0.00 0.00 4.04


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.