Multiple sequence alignment - TraesCS5D01G365700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G365700 chr5D 100.000 2603 0 0 1 2603 442842675 442845277 0.000000e+00 4807.0
1 TraesCS5D01G365700 chr5D 94.808 1040 54 0 877 1916 285330539 285329500 0.000000e+00 1622.0
2 TraesCS5D01G365700 chr5D 97.235 868 22 2 1737 2603 318011444 318010578 0.000000e+00 1469.0
3 TraesCS5D01G365700 chr5D 96.721 854 26 2 1 854 565071340 565070489 0.000000e+00 1421.0
4 TraesCS5D01G365700 chr5D 96.009 877 28 5 1 870 18221343 18222219 0.000000e+00 1419.0
5 TraesCS5D01G365700 chr5D 94.635 876 46 1 855 1730 318013749 318012875 0.000000e+00 1356.0
6 TraesCS5D01G365700 chr5D 96.442 534 18 1 2070 2603 285324969 285324437 0.000000e+00 880.0
7 TraesCS5D01G365700 chr5D 95.989 349 14 0 1733 2081 285329500 285329152 3.760000e-158 568.0
8 TraesCS5D01G365700 chr5D 96.410 195 7 0 1726 1920 318011638 318011444 3.230000e-84 322.0
9 TraesCS5D01G365700 chr7D 97.718 1753 36 2 855 2603 217838271 217836519 0.000000e+00 3013.0
10 TraesCS5D01G365700 chr7D 96.400 861 27 2 1 858 456179620 456180479 0.000000e+00 1415.0
11 TraesCS5D01G365700 chr7D 96.253 854 30 2 1 854 98828826 98827975 0.000000e+00 1399.0
12 TraesCS5D01G365700 chr4D 95.301 1596 68 2 1008 2603 277203327 277201739 0.000000e+00 2525.0
13 TraesCS5D01G365700 chr6A 96.913 907 28 0 1607 2513 552988847 552989753 0.000000e+00 1520.0
14 TraesCS5D01G365700 chr6A 95.544 763 28 4 855 1616 552986548 552987305 0.000000e+00 1216.0
15 TraesCS5D01G365700 chr6A 96.964 494 14 1 2110 2603 552989751 552990243 0.000000e+00 828.0
16 TraesCS5D01G365700 chr1D 97.424 854 22 0 1 854 330165929 330165076 0.000000e+00 1456.0
17 TraesCS5D01G365700 chr1D 95.819 861 36 0 1 861 460056378 460055518 0.000000e+00 1391.0
18 TraesCS5D01G365700 chrUn 97.193 855 24 0 1 855 137623486 137624340 0.000000e+00 1447.0
19 TraesCS5D01G365700 chr3D 97.076 855 24 1 1 855 606275364 606274511 0.000000e+00 1439.0
20 TraesCS5D01G365700 chr2D 95.833 864 33 3 1 863 549405715 549404854 0.000000e+00 1393.0
21 TraesCS5D01G365700 chr6D 95.833 48 2 0 2542 2589 277045067 277045114 7.720000e-11 78.7
22 TraesCS5D01G365700 chr5A 92.683 41 2 1 2550 2589 560765686 560765726 1.010000e-04 58.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G365700 chr5D 442842675 442845277 2602 False 4807 4807 100.000000 1 2603 1 chr5D.!!$F2 2602
1 TraesCS5D01G365700 chr5D 565070489 565071340 851 True 1421 1421 96.721000 1 854 1 chr5D.!!$R2 853
2 TraesCS5D01G365700 chr5D 18221343 18222219 876 False 1419 1419 96.009000 1 870 1 chr5D.!!$F1 869
3 TraesCS5D01G365700 chr5D 285329152 285330539 1387 True 1095 1622 95.398500 877 2081 2 chr5D.!!$R3 1204
4 TraesCS5D01G365700 chr5D 318010578 318013749 3171 True 1049 1469 96.093333 855 2603 3 chr5D.!!$R4 1748
5 TraesCS5D01G365700 chr5D 285324437 285324969 532 True 880 880 96.442000 2070 2603 1 chr5D.!!$R1 533
6 TraesCS5D01G365700 chr7D 217836519 217838271 1752 True 3013 3013 97.718000 855 2603 1 chr7D.!!$R2 1748
7 TraesCS5D01G365700 chr7D 456179620 456180479 859 False 1415 1415 96.400000 1 858 1 chr7D.!!$F1 857
8 TraesCS5D01G365700 chr7D 98827975 98828826 851 True 1399 1399 96.253000 1 854 1 chr7D.!!$R1 853
9 TraesCS5D01G365700 chr4D 277201739 277203327 1588 True 2525 2525 95.301000 1008 2603 1 chr4D.!!$R1 1595
10 TraesCS5D01G365700 chr6A 552986548 552990243 3695 False 1188 1520 96.473667 855 2603 3 chr6A.!!$F1 1748
11 TraesCS5D01G365700 chr1D 330165076 330165929 853 True 1456 1456 97.424000 1 854 1 chr1D.!!$R1 853
12 TraesCS5D01G365700 chr1D 460055518 460056378 860 True 1391 1391 95.819000 1 861 1 chr1D.!!$R2 860
13 TraesCS5D01G365700 chrUn 137623486 137624340 854 False 1447 1447 97.193000 1 855 1 chrUn.!!$F1 854
14 TraesCS5D01G365700 chr3D 606274511 606275364 853 True 1439 1439 97.076000 1 855 1 chr3D.!!$R1 854
15 TraesCS5D01G365700 chr2D 549404854 549405715 861 True 1393 1393 95.833000 1 863 1 chr2D.!!$R1 862

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
205 206 1.182667 AATGGAGGATGACGTCACGA 58.817 50.0 22.71 5.67 33.25 4.35 F
1035 1043 1.046472 AGAACGTGGTGGTGGTGAGA 61.046 55.0 0.00 0.00 0.00 3.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1366 1374 0.179111 ACGACATACATGGGCAGACG 60.179 55.000 0.0 0.0 0.0 4.18 R
2016 5182 4.754618 GGGGCAATACAAAAACAAGGAAAG 59.245 41.667 0.0 0.0 0.0 2.62 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
205 206 1.182667 AATGGAGGATGACGTCACGA 58.817 50.000 22.71 5.67 33.25 4.35
318 319 1.493950 GATTGACATGAGCCGGCTCG 61.494 60.000 42.48 33.45 45.48 5.03
411 415 2.852495 GATCGTTGCCAGAAGCCCGA 62.852 60.000 0.00 0.00 44.62 5.14
629 633 1.375523 AGCGGTTTAAGGGCGACAG 60.376 57.895 0.00 0.00 0.00 3.51
728 732 2.353011 CGTAGGCTTTTACCTTCACCGA 60.353 50.000 0.00 0.00 41.50 4.69
820 824 2.097825 GGCTCCACGACTAAGTCCTAA 58.902 52.381 0.00 0.00 0.00 2.69
1035 1043 1.046472 AGAACGTGGTGGTGGTGAGA 61.046 55.000 0.00 0.00 0.00 3.27
1366 1374 5.296780 TCTCCATTCACACTTTTCTGTCAAC 59.703 40.000 0.00 0.00 0.00 3.18
1388 1396 1.016627 CTGCCCATGTATGTCGTTGG 58.983 55.000 0.00 0.00 0.00 3.77
1399 1407 3.923864 TCGTTGGCTGGTGCGTCT 61.924 61.111 0.00 0.00 40.82 4.18
1753 4553 7.394016 TCCTGCTATTTTGTGAATGTTCTCTA 58.606 34.615 0.00 0.00 0.00 2.43
1803 4603 7.173218 CAGTTATCAATGGTCTACTGTGTTGTT 59.827 37.037 0.00 0.00 0.00 2.83
1842 4642 0.636101 AGAGGAGAGGAGGATGCACT 59.364 55.000 0.00 0.00 0.00 4.40
2159 5325 8.929260 AAATCAAGCCTCATACATCATTATCA 57.071 30.769 0.00 0.00 0.00 2.15
2211 5377 7.049754 AGGCAACCCAATAAAATCATGAATTC 58.950 34.615 0.00 0.00 37.17 2.17
2284 5452 7.883229 AAAAATTATTGGTGACGATGTTTCC 57.117 32.000 0.00 0.00 35.53 3.13
2451 6020 3.437642 AGGCTAGCCTGTTTTGCAA 57.562 47.368 35.59 0.00 46.22 4.08
2544 6116 4.268884 TGTTTCTTACGCCATTTTTGTTGC 59.731 37.500 0.00 0.00 0.00 4.17
2590 6162 6.521162 TCTTGTTACTGATAGTGCTTTGTCA 58.479 36.000 0.00 0.00 0.00 3.58
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
318 319 2.173569 ACATTAGGCCCCAGATTGACTC 59.826 50.000 0.00 0.00 0.00 3.36
411 415 4.081476 GCCCATTATCTTGAAACTTGGCTT 60.081 41.667 0.00 0.00 32.53 4.35
542 546 2.591715 CCCGGCCGGCTCATAAAG 60.592 66.667 39.46 18.81 0.00 1.85
543 547 3.084646 TCCCGGCCGGCTCATAAA 61.085 61.111 39.46 13.75 0.00 1.40
629 633 0.943359 CCGGCTCTCGATCAGATTGC 60.943 60.000 0.00 0.00 42.43 3.56
728 732 1.587066 TATACTGGTTCGGCCCCTTT 58.413 50.000 0.00 0.00 36.04 3.11
820 824 1.679305 ACGGCAGATGTCCTCGAGT 60.679 57.895 12.31 0.00 0.00 4.18
1035 1043 2.047274 CGGGTCAGTGTCGCCATT 60.047 61.111 0.00 0.00 0.00 3.16
1212 1220 0.957395 CTGATCTTGCCGCACCACTT 60.957 55.000 0.00 0.00 0.00 3.16
1366 1374 0.179111 ACGACATACATGGGCAGACG 60.179 55.000 0.00 0.00 0.00 4.18
1388 1396 3.375299 AGATATCAAAAAGACGCACCAGC 59.625 43.478 5.32 0.00 37.42 4.85
1399 1407 7.067372 ACGAGCAATCAATGGAGATATCAAAAA 59.933 33.333 5.32 0.00 0.00 1.94
1803 4603 4.986783 TCTCACAGAAGTCAAGTAGGAGA 58.013 43.478 0.00 0.00 0.00 3.71
1842 4642 5.813672 GCAAACCTATGACGACCAAACTATA 59.186 40.000 0.00 0.00 0.00 1.31
1981 5147 7.914859 TGAATATGCACATGAATCTAGAGGAT 58.085 34.615 0.00 0.00 35.97 3.24
2016 5182 4.754618 GGGGCAATACAAAAACAAGGAAAG 59.245 41.667 0.00 0.00 0.00 2.62
2159 5325 6.770785 TGTCTGCAGAATACAAACTAAACCTT 59.229 34.615 20.19 0.00 0.00 3.50
2211 5377 5.050227 CCTGTGCACAAAACATAAAATGTGG 60.050 40.000 21.98 9.22 44.07 4.17
2284 5452 9.798885 CAGTAAAAGAGAAGAATAAGTTTGTCG 57.201 33.333 0.00 0.00 0.00 4.35
2544 6116 9.480538 CAAGATCAAACAAAAATGAAACAACAG 57.519 29.630 0.00 0.00 0.00 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.