Multiple sequence alignment - TraesCS5D01G356600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G356600 chr5D 100.000 2635 0 0 1 2635 437728586 437725952 0.000000e+00 4867
1 TraesCS5D01G356600 chr5D 97.364 2314 54 6 324 2635 51585540 51583232 0.000000e+00 3928
2 TraesCS5D01G356600 chr5A 95.652 2645 89 10 1 2631 40241617 40238985 0.000000e+00 4224
3 TraesCS5D01G356600 chr5A 96.155 2523 66 6 1 2521 562123247 562120754 0.000000e+00 4093
4 TraesCS5D01G356600 chr5A 92.774 2671 139 25 1 2630 310017886 310020543 0.000000e+00 3814
5 TraesCS5D01G356600 chr5A 96.192 2206 59 7 324 2521 687969729 687971917 0.000000e+00 3585
6 TraesCS5D01G356600 chr7D 95.405 2655 90 10 1 2631 107242160 107239514 0.000000e+00 4198
7 TraesCS5D01G356600 chr1A 94.252 2662 102 14 1 2633 16224734 16227373 0.000000e+00 4021
8 TraesCS5D01G356600 chr4B 94.774 2526 74 20 129 2635 11627178 11624692 0.000000e+00 3880
9 TraesCS5D01G356600 chr1D 96.717 2315 68 6 324 2630 152626282 152628596 0.000000e+00 3847
10 TraesCS5D01G356600 chr1D 95.825 527 11 3 2105 2630 152482806 152483322 0.000000e+00 841
11 TraesCS5D01G356600 chr6A 95.714 2310 71 11 324 2631 577152227 577154510 0.000000e+00 3692
12 TraesCS5D01G356600 chr3D 93.277 1413 62 13 1247 2630 600413135 600414543 0.000000e+00 2052
13 TraesCS5D01G356600 chr2D 91.192 386 24 5 2253 2630 67035101 67035484 1.400000e-142 516
14 TraesCS5D01G356600 chr5B 94.949 198 9 1 1 197 34584609 34584412 2.550000e-80 309
15 TraesCS5D01G356600 chr5B 93.939 198 11 1 1 197 547150327 547150130 5.510000e-77 298
16 TraesCS5D01G356600 chr5B 92.929 198 12 2 1 197 31737421 31737225 1.190000e-73 287
17 TraesCS5D01G356600 chr5B 97.516 161 4 0 1 161 36453256 36453096 2.580000e-70 276
18 TraesCS5D01G356600 chr5B 97.516 161 4 0 1 161 621788478 621788318 2.580000e-70 276
19 TraesCS5D01G356600 chr3B 93.939 198 11 1 1 197 794135616 794135813 5.510000e-77 298
20 TraesCS5D01G356600 chr3B 98.137 161 3 0 1 161 632150335 632150495 5.550000e-72 281
21 TraesCS5D01G356600 chr2B 92.929 198 13 1 1 197 34398336 34398533 1.190000e-73 287
22 TraesCS5D01G356600 chr6B 96.894 161 5 0 1 161 586281614 586281454 1.200000e-68 270
23 TraesCS5D01G356600 chr6B 95.031 161 8 0 1 161 21617501 21617341 1.210000e-63 254


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G356600 chr5D 437725952 437728586 2634 True 4867 4867 100.000 1 2635 1 chr5D.!!$R2 2634
1 TraesCS5D01G356600 chr5D 51583232 51585540 2308 True 3928 3928 97.364 324 2635 1 chr5D.!!$R1 2311
2 TraesCS5D01G356600 chr5A 40238985 40241617 2632 True 4224 4224 95.652 1 2631 1 chr5A.!!$R1 2630
3 TraesCS5D01G356600 chr5A 562120754 562123247 2493 True 4093 4093 96.155 1 2521 1 chr5A.!!$R2 2520
4 TraesCS5D01G356600 chr5A 310017886 310020543 2657 False 3814 3814 92.774 1 2630 1 chr5A.!!$F1 2629
5 TraesCS5D01G356600 chr5A 687969729 687971917 2188 False 3585 3585 96.192 324 2521 1 chr5A.!!$F2 2197
6 TraesCS5D01G356600 chr7D 107239514 107242160 2646 True 4198 4198 95.405 1 2631 1 chr7D.!!$R1 2630
7 TraesCS5D01G356600 chr1A 16224734 16227373 2639 False 4021 4021 94.252 1 2633 1 chr1A.!!$F1 2632
8 TraesCS5D01G356600 chr4B 11624692 11627178 2486 True 3880 3880 94.774 129 2635 1 chr4B.!!$R1 2506
9 TraesCS5D01G356600 chr1D 152626282 152628596 2314 False 3847 3847 96.717 324 2630 1 chr1D.!!$F2 2306
10 TraesCS5D01G356600 chr1D 152482806 152483322 516 False 841 841 95.825 2105 2630 1 chr1D.!!$F1 525
11 TraesCS5D01G356600 chr6A 577152227 577154510 2283 False 3692 3692 95.714 324 2631 1 chr6A.!!$F1 2307
12 TraesCS5D01G356600 chr3D 600413135 600414543 1408 False 2052 2052 93.277 1247 2630 1 chr3D.!!$F1 1383

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
984 1038 2.242965 TCCATGCACTGAATCTTGGGAT 59.757 45.455 0.0 0.0 0.0 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1877 1950 5.050644 ACAATATGAATATGCATGGCACG 57.949 39.13 10.16 0.0 43.04 5.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
43 45 4.863707 GGCGATGATGAAGCCTGA 57.136 55.556 0.00 0.00 46.83 3.86
160 162 8.253810 TCCTTTGTCTCATCATCTTAACTACTG 58.746 37.037 0.00 0.00 0.00 2.74
163 165 6.935167 TGTCTCATCATCTTAACTACTGCAA 58.065 36.000 0.00 0.00 0.00 4.08
745 799 5.511571 CATGAAACTGAGATTGCTAGCATG 58.488 41.667 20.13 4.93 0.00 4.06
898 952 3.406764 CCAGCCTTCTATCATGCTTACC 58.593 50.000 0.00 0.00 30.08 2.85
979 1033 2.490903 GCTGTTCCATGCACTGAATCTT 59.509 45.455 3.32 0.00 0.00 2.40
984 1038 2.242965 TCCATGCACTGAATCTTGGGAT 59.757 45.455 0.00 0.00 0.00 3.85
1113 1167 1.801913 CGACTTCAAGGACGCTCGG 60.802 63.158 0.00 0.00 0.00 4.63
1336 1398 5.347635 TGCATGAGTTTTACTACTGCTAACG 59.652 40.000 0.00 0.00 36.93 3.18
1566 1631 3.949113 TGGTGGTTTTGTTCTACTTGGAC 59.051 43.478 0.00 0.00 0.00 4.02
1573 1638 3.394674 TGTTCTACTTGGACGCATTGA 57.605 42.857 0.00 0.00 0.00 2.57
1606 1671 1.567537 CGAACGGATGCAACAACGT 59.432 52.632 0.00 0.00 41.88 3.99
1975 2048 7.938140 AAAAGCATGGTACTAGCTGAATTTA 57.062 32.000 0.00 0.00 38.91 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
320 346 8.976353 AGACAGTAGTAGTAGTAGTAGTAGCAA 58.024 37.037 0.49 0.00 0.00 3.91
426 452 4.622220 GCATGCTGGAATTCAACTCCATTT 60.622 41.667 11.37 0.00 42.12 2.32
653 680 9.442047 CCATACTTAACAGATATTCATTCCTCC 57.558 37.037 0.00 0.00 0.00 4.30
721 749 3.376234 TGCTAGCAATCTCAGTTTCATGC 59.624 43.478 16.84 0.00 0.00 4.06
722 750 5.296035 TCATGCTAGCAATCTCAGTTTCATG 59.704 40.000 23.54 10.55 0.00 3.07
745 799 7.681939 TCAAAGGGTGTATCTTGTGTAAATC 57.318 36.000 0.00 0.00 0.00 2.17
898 952 5.108385 ACTACCGTGCAAAGAAAAATCTG 57.892 39.130 0.00 0.00 0.00 2.90
1254 1316 9.179909 CTAGAAGTGTATCTTAAGAGAGACCAA 57.820 37.037 20.24 6.22 42.18 3.67
1270 1332 6.650427 TGAGTCAGAAAAGCTAGAAGTGTA 57.350 37.500 0.00 0.00 0.00 2.90
1566 1631 2.669924 CTCGATGATGGGTATCAATGCG 59.330 50.000 0.00 0.00 45.82 4.73
1573 1638 1.335964 CGTTCGCTCGATGATGGGTAT 60.336 52.381 0.00 0.00 0.00 2.73
1877 1950 5.050644 ACAATATGAATATGCATGGCACG 57.949 39.130 10.16 0.00 43.04 5.34
1943 2016 5.278266 GCTAGTACCATGCTTTTTGTTGTCA 60.278 40.000 0.00 0.00 0.00 3.58


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.