Multiple sequence alignment - TraesCS5D01G348100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G348100 chr5D 100.000 3072 0 0 1 3072 433652236 433649165 0.000000e+00 5674.0
1 TraesCS5D01G348100 chr5D 98.155 3090 32 9 1 3072 431811565 431814647 0.000000e+00 5367.0
2 TraesCS5D01G348100 chr5D 96.669 3122 43 15 1 3072 513348138 513351248 0.000000e+00 5132.0
3 TraesCS5D01G348100 chr5D 79.419 413 61 18 1567 1962 433509836 433509431 1.400000e-68 270.0
4 TraesCS5D01G348100 chr5D 79.167 408 69 10 1568 1962 431889387 431889791 5.050000e-68 268.0
5 TraesCS5D01G348100 chr5D 78.870 407 67 13 1571 1962 433515682 433515280 1.090000e-64 257.0
6 TraesCS5D01G348100 chr5D 77.926 376 58 13 1600 1962 513288815 513288452 8.630000e-51 211.0
7 TraesCS5D01G348100 chr5B 92.865 953 40 11 1265 2190 522791521 522790570 0.000000e+00 1358.0
8 TraesCS5D01G348100 chr5B 96.314 814 19 5 2267 3072 522786581 522785771 0.000000e+00 1327.0
9 TraesCS5D01G348100 chr5B 96.069 814 21 5 2267 3072 522723667 522722857 0.000000e+00 1315.0
10 TraesCS5D01G348100 chr5B 96.041 783 19 6 2267 3041 522678327 522677549 0.000000e+00 1264.0
11 TraesCS5D01G348100 chr5B 91.677 793 34 4 1 766 522815068 522814281 0.000000e+00 1070.0
12 TraesCS5D01G348100 chr5B 91.368 475 20 7 759 1215 522792259 522791788 5.590000e-177 630.0
13 TraesCS5D01G348100 chr5B 79.259 405 68 10 1571 1962 522622939 522622538 5.050000e-68 268.0
14 TraesCS5D01G348100 chr5B 90.110 91 1 1 2188 2270 522678438 522678348 9.000000e-21 111.0
15 TraesCS5D01G348100 chr5B 90.110 91 1 1 2188 2270 522723778 522723688 9.000000e-21 111.0
16 TraesCS5D01G348100 chr5B 90.110 91 1 1 2188 2270 522786692 522786602 9.000000e-21 111.0
17 TraesCS5D01G348100 chr5A 95.916 808 21 6 2274 3072 547001555 547002359 0.000000e+00 1299.0
18 TraesCS5D01G348100 chr5A 92.271 828 29 9 1477 2270 546998798 546999624 0.000000e+00 1142.0
19 TraesCS5D01G348100 chr5A 85.625 800 68 16 702 1477 546997034 546997810 0.000000e+00 797.0
20 TraesCS5D01G348100 chr5A 80.653 398 63 11 71 459 546996212 546996604 2.320000e-76 296.0
21 TraesCS5D01G348100 chr5A 80.303 132 16 4 1046 1167 547023214 547023345 1.170000e-14 91.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G348100 chr5D 433649165 433652236 3071 True 5674.0 5674 100.00000 1 3072 1 chr5D.!!$R3 3071
1 TraesCS5D01G348100 chr5D 431811565 431814647 3082 False 5367.0 5367 98.15500 1 3072 1 chr5D.!!$F1 3071
2 TraesCS5D01G348100 chr5D 513348138 513351248 3110 False 5132.0 5132 96.66900 1 3072 1 chr5D.!!$F3 3071
3 TraesCS5D01G348100 chr5B 522814281 522815068 787 True 1070.0 1070 91.67700 1 766 1 chr5B.!!$R2 765
4 TraesCS5D01G348100 chr5B 522785771 522792259 6488 True 856.5 1358 92.66425 759 3072 4 chr5B.!!$R5 2313
5 TraesCS5D01G348100 chr5B 522722857 522723778 921 True 713.0 1315 93.08950 2188 3072 2 chr5B.!!$R4 884
6 TraesCS5D01G348100 chr5B 522677549 522678438 889 True 687.5 1264 93.07550 2188 3041 2 chr5B.!!$R3 853
7 TraesCS5D01G348100 chr5A 546996212 547002359 6147 False 883.5 1299 88.61625 71 3072 4 chr5A.!!$F2 3001

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
267 283 0.951040 CAAGTGGGCGACAGAGAACC 60.951 60.000 1.61 0.0 0.00 3.62 F
606 666 1.336125 GTTGCACTTGCTCTTGCTCTT 59.664 47.619 2.33 0.0 42.66 2.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1925 3386 1.206610 TCAGAGTCTTGCTCCTCATGC 59.793 52.381 0.0 0.0 45.21 4.06 R
2373 9662 8.985315 AGATTATCTAAACAGCCAATCAATCA 57.015 30.769 0.0 0.0 0.00 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
267 283 0.951040 CAAGTGGGCGACAGAGAACC 60.951 60.000 1.61 0.00 0.00 3.62
423 439 2.027625 GCGGTTCCTCTGTGTTCCG 61.028 63.158 0.00 0.00 40.72 4.30
424 440 1.663739 CGGTTCCTCTGTGTTCCGA 59.336 57.895 0.00 0.00 40.29 4.55
606 666 1.336125 GTTGCACTTGCTCTTGCTCTT 59.664 47.619 2.33 0.00 42.66 2.85
607 667 2.549064 TGCACTTGCTCTTGCTCTTA 57.451 45.000 2.33 0.00 42.66 2.10
608 668 2.146342 TGCACTTGCTCTTGCTCTTAC 58.854 47.619 2.33 0.00 42.66 2.34
609 669 2.146342 GCACTTGCTCTTGCTCTTACA 58.854 47.619 0.00 0.00 40.48 2.41
610 670 2.159234 GCACTTGCTCTTGCTCTTACAG 59.841 50.000 0.00 0.00 40.48 2.74
766 975 2.205342 CTATCCACTCCCCTTCCCAAA 58.795 52.381 0.00 0.00 0.00 3.28
953 1173 3.823330 GTCCGCCCTCGTCGACAT 61.823 66.667 17.16 0.00 30.62 3.06
977 1197 4.547905 CTACGTCGACGGCCGCAT 62.548 66.667 37.89 20.67 44.95 4.73
1925 3386 0.036952 ACAGTCGTGGATGCTCTTGG 60.037 55.000 0.00 0.00 0.00 3.61
2028 3489 1.523758 TCAAGCTCCTCGAAAAAGGC 58.476 50.000 0.00 0.00 36.29 4.35
2373 9662 7.081857 TGTGGTTTACTTTACCTCCTAACAT 57.918 36.000 0.00 0.00 36.60 2.71
2998 10293 6.132791 TGCCACTTGAACAACGTATTTTTA 57.867 33.333 0.00 0.00 0.00 1.52
3057 10355 1.454572 GCACACATGCCCACAAGACA 61.455 55.000 0.00 0.00 46.97 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
133 146 2.671070 GCTGTTGGCCTGCCTCTA 59.329 61.111 9.97 0.00 36.94 2.43
267 283 4.170062 TTCTCTACGTCGCCGCCG 62.170 66.667 0.00 0.00 37.70 6.46
423 439 3.536956 TTGACCGATAGAACCCACATC 57.463 47.619 0.00 0.00 39.76 3.06
424 440 3.711704 AGATTGACCGATAGAACCCACAT 59.288 43.478 0.00 0.00 39.76 3.21
766 975 1.306568 GGGAGAGAGCTCTTGGGGT 60.307 63.158 19.36 0.21 40.61 4.95
860 1080 0.034059 GCGACATCGGGGAAGATCAT 59.966 55.000 3.08 0.00 40.23 2.45
953 1173 2.683859 CCGTCGACGTAGACCAGCA 61.684 63.158 33.49 0.00 37.85 4.41
977 1197 2.230994 CTAGCTGGTTGAGGCGCTGA 62.231 60.000 7.64 0.00 34.14 4.26
1454 1912 1.609210 TGGTCGACCCAGCAGATCA 60.609 57.895 31.19 6.76 38.72 2.92
1925 3386 1.206610 TCAGAGTCTTGCTCCTCATGC 59.793 52.381 0.00 0.00 45.21 4.06
2373 9662 8.985315 AGATTATCTAAACAGCCAATCAATCA 57.015 30.769 0.00 0.00 0.00 2.57
2998 10293 5.357032 GGTAGCCTATGTTTGTGTGCTTTAT 59.643 40.000 0.00 0.00 0.00 1.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.